Mutagenetix > Incidental Mutation

Incidental Mutation 'R0550:Atp6v1c1'

45118

Institutional Source

Beutler Lab

Gene Symbol

Atp6v1c1

Ensembl Gene

ENSMUSG00000022295

Gene Name

ATPase, H+ transporting, lysosomal V1 subunit C1

Synonyms

1700025B18Rik

MMRRC Submission

038742-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0550 (G1)

Quality Score

176

Status

Validated

Chromosome

Chromosomal Location

38661933-38692446 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 38682929 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000153731 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022904] [ENSMUST00000226533]

AlphaFold

Q9Z1G3

Predicted Effect

probably benign
Transcript: ENSMUST00000022904

SMART Domains

Protein: ENSMUSP00000022904
Gene: ENSMUSG00000022295

Domain	Start	End	E-Value	Type
Pfam:V-ATPase_C	4	370	1.2e-168	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000226533

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227482

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228475

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 97.0%
20x: 94.2%

Validation Efficiency

99% (76/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene is one of two genes that encode the V1 domain C subunit proteins and is found ubiquitously. This C subunit is analogous but not homologous to gamma subunit of F-ATPases. Previously, this gene was designated ATP6D. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	T	11: 110,293,840	Y947N	probably damaging	Het
Acss3	C	A	10: 107,053,471	G163C	probably damaging	Het
Adcy10	A	G	1: 165,565,315	T1367A	probably benign	Het
Adcy2	A	T	13: 68,982,361	S136T	probably benign	Het
Ahdc1	G	A	4: 133,063,037	V530I	probably benign	Het
Aldh16a1	C	T	7: 45,146,229		probably null	Het
Ankrd36	T	C	11: 5,607,429		probably null	Het
Aqr	A	C	2: 114,132,976	N664K	probably damaging	Het
Atp8b2	C	T	3: 89,959,061		probably benign	Het
Bbx	T	C	16: 50,274,533		probably benign	Het
Bmper	T	A	9: 23,373,885	D243E	probably benign	Het
Casz1	GCCACCACCACCACCACCACCAC	GCCACCACCACCACCACCAC	4: 148,952,284		probably benign	Het
Catsperd	T	C	17: 56,663,427		probably null	Het
Ccdc92b	T	A	11: 74,629,945		probably null	Het
Cd2bp2	G	T	7: 127,193,824	T342K	probably damaging	Het
Clrn3	T	A	7: 135,528,425	I27F	possibly damaging	Het
Cnih3	TTGACGAG	T	1: 181,406,477		probably null	Het
Cntnap3	T	C	13: 64,762,000	T764A	possibly damaging	Het
Cttnbp2	T	G	6: 18,435,309	K183N	possibly damaging	Het
Cwc27	G	A	13: 104,804,949	P155L	probably damaging	Het
Dcaf10	T	C	4: 45,372,753	S389P	probably benign	Het
Ddx18	T	C	1: 121,555,375	K561E	probably benign	Het
Dkk3	A	G	7: 112,158,245	F51L	probably damaging	Het
Dnaic1	C	T	4: 41,596,274	R20*	probably null	Het
Dr1	G	A	5: 108,269,605	G6S	probably benign	Het
Dync2h1	A	T	9: 7,120,954		probably null	Het
Eif3l	A	G	15: 79,076,867	Y16C	probably damaging	Het
Epb41	A	G	4: 131,975,613	I464T	probably damaging	Het
Erc2	A	G	14: 28,271,651	K546E	possibly damaging	Het
F830045P16Rik	T	C	2: 129,463,509	D315G	probably damaging	Het
Fads6	A	G	11: 115,296,677	I64T	probably benign	Het
Fshr	T	C	17: 89,045,125	N107S	probably benign	Het
Gbp11	A	T	5: 105,343,750	N60K	probably benign	Het
Gm2a	C	T	11: 55,103,665	Q54*	probably null	Het
Hydin	A	G	8: 110,587,775	D4297G	probably benign	Het
Il6st	G	A	13: 112,475,114		probably null	Het
Inpp4b	T	A	8: 81,997,337	H499Q	probably benign	Het
Kif5c	A	G	2: 49,758,912	K956R	possibly damaging	Het
Krt74	G	A	15: 101,760,679		noncoding transcript	Het
Map3k9	A	T	12: 81,725,781	L649Q	probably damaging	Het
Mdn1	A	G	4: 32,730,479	D2871G	probably benign	Het
Mylk4	T	C	13: 32,716,666	T294A	probably benign	Het
Nbeal2	C	T	9: 110,642,158	V252I	probably benign	Het
Nectin3	A	G	16: 46,458,820	I265T	possibly damaging	Het
Olfr1065	A	T	2: 86,445,876	Y35*	probably null	Het
Olfr1109	G	T	2: 87,093,129	H89Q	probably benign	Het
Olfr1259	A	G	2: 89,943,389	I242T	probably damaging	Het
Olfr1447	A	T	19: 12,901,800		probably null	Het
Olfr181	A	G	16: 58,926,385	F62S	probably damaging	Het
Olfr554	G	A	7: 102,640,950	E235K	possibly damaging	Het
Olfr910	T	A	9: 38,539,380	C162S	probably damaging	Het
Opn1sw	A	T	6: 29,380,204	L71Q	probably damaging	Het
Pced1a	G	A	2: 130,419,633	P367S	probably benign	Het
Pkhd1	A	T	1: 20,347,223	M2568K	probably null	Het
Pla2r1	A	G	2: 60,425,350		probably null	Het
Plpp1	T	C	13: 112,834,985	I62T	probably benign	Het
Polr3g	G	A	13: 81,694,773	T41I	probably damaging	Het
Ptch2	T	C	4: 117,096,433		probably benign	Het
Sema4g	A	T	19: 44,997,665	H315L	probably benign	Het
Setd1b	G	T	5: 123,157,660	S1097I	unknown	Het
Sfxn4	A	G	19: 60,850,945		probably benign	Het
Sh3tc1	T	C	5: 35,699,784	E1237G	probably damaging	Het
Slc25a38	A	T	9: 120,123,643	N287I	probably benign	Het
Slc25a48	A	G	13: 56,448,998	T31A	probably benign	Het
Slc6a12	G	A	6: 121,356,918	V238I	probably damaging	Het
Slc8b1	A	G	5: 120,531,155		probably benign	Het
Slco4c1	A	C	1: 96,867,859	V158G	probably damaging	Het
Sptbn4	T	C	7: 27,364,378	T2208A	probably benign	Het
Srebf1	G	A	11: 60,201,676	T843I	probably benign	Het
Srl	A	G	16: 4,487,565	W101R	probably damaging	Het
St6galnac4	T	A	2: 32,594,019	C76*	probably null	Het
Tdrd3	C	A	14: 87,486,220	T290K	probably damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Trpm3	A	G	19: 22,987,812	E1547G	probably damaging	Het
Ubn1	A	G	16: 5,062,620		probably null	Het
Usp10	T	A	8: 119,947,801	I456K	probably damaging	Het
Usp6nl	A	G	2: 6,400,323		probably benign	Het
Vit	T	A	17: 78,624,793	V443E	possibly damaging	Het
Whamm	G	A	7: 81,586,224	V392I	possibly damaging	Het
Zfhx4	A	G	3: 5,400,494	K1904R	probably damaging	Het
Zfp352	A	T	4: 90,224,690	T356S	probably damaging	Het

Other mutations in Atp6v1c1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00496:Atp6v1c1	APN	15	38686856	missense	probably damaging	0.99
IGL01371:Atp6v1c1	APN	15	38682960	missense	probably benign
IGL02987:Atp6v1c1	APN	15	38690562	missense	possibly damaging	0.70
P0029:Atp6v1c1	UTSW	15	38686902	unclassified	probably benign
R0669:Atp6v1c1	UTSW	15	38677528	missense	probably benign	0.00
R2033:Atp6v1c1	UTSW	15	38673966	critical splice donor site	probably null
R3021:Atp6v1c1	UTSW	15	38689216	missense	possibly damaging	0.75
R4475:Atp6v1c1	UTSW	15	38677573	missense	probably benign	0.03
R4612:Atp6v1c1	UTSW	15	38677612	missense	probably damaging	1.00
R4798:Atp6v1c1	UTSW	15	38689176	missense	probably damaging	1.00
R5095:Atp6v1c1	UTSW	15	38679413	critical splice donor site	probably null
R5600:Atp6v1c1	UTSW	15	38686863	missense	probably benign	0.17
R6177:Atp6v1c1	UTSW	15	38673928	nonsense	probably null
R6434:Atp6v1c1	UTSW	15	38677546	missense	probably damaging	0.99
R6916:Atp6v1c1	UTSW	15	38677581	missense	probably benign	0.00
R6973:Atp6v1c1	UTSW	15	38690550	missense	probably damaging	1.00
R7395:Atp6v1c1	UTSW	15	38691705	makesense	probably null
R7607:Atp6v1c1	UTSW	15	38683011	critical splice donor site	probably null
R7712:Atp6v1c1	UTSW	15	38686805	missense	probably benign	0.00
R8830:Atp6v1c1	UTSW	15	38677545	missense	probably damaging	0.98
R9195:Atp6v1c1	UTSW	15	38673954	missense	probably damaging	1.00
R9640:Atp6v1c1	UTSW	15	38689137	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGTTAACAAGCCAAGCTGTGCCTC -3'
(R):5'- GGCATCATCTTCCCGGTAAGTGTG -3'

Sequencing Primer
(F):5'- AAGCTGTGCCTCTGTCG -3'
(R):5'- CCTCCATCTATGAAAATGAGGGGTC -3'

Posted On

2013-06-11