Incidental Mutation 'R5716:Uqcrc1'
ID451183
Institutional Source Beutler Lab
Gene Symbol Uqcrc1
Ensembl Gene ENSMUSG00000025651
Gene Nameubiquinol-cytochrome c reductase core protein 1
Synonyms1110032G10Rik
MMRRC Submission 043187-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R5716 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108936633-108949623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108947405 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 298 (N298D)
Ref Sequence ENSEMBL: ENSMUSP00000026743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026743] [ENSMUST00000194047] [ENSMUST00000194469] [ENSMUST00000195738]
Predicted Effect probably benign
Transcript: ENSMUST00000026743
AA Change: N298D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026743
Gene: ENSMUSG00000025651
AA Change: N298D

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
Pfam:Peptidase_M16 58 205 2.1e-54 PFAM
Pfam:Peptidase_M16_C 210 395 3.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193607
Predicted Effect probably benign
Transcript: ENSMUST00000194047
SMART Domains Protein: ENSMUSP00000141435
Gene: ENSMUSG00000025651

DomainStartEndE-ValueType
Pfam:Peptidase_M16 41 188 7.7e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194469
SMART Domains Protein: ENSMUSP00000141743
Gene: ENSMUSG00000025651

DomainStartEndE-ValueType
Pfam:Peptidase_M16_C 1 94 5.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195387
Predicted Effect probably benign
Transcript: ENSMUST00000195738
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T C 11: 58,421,768 V24A possibly damaging Het
Abca14 G A 7: 120,246,994 probably null Het
Acad12 A G 5: 121,609,983 V124A probably benign Het
Alg1 A T 16: 5,239,956 D238V probably damaging Het
Bcar3 A G 3: 122,512,915 E179G probably damaging Het
Brf2 A G 8: 27,126,046 S104P probably benign Het
Coq8a A T 1: 180,179,260 Y21N possibly damaging Het
Cramp1l A G 17: 24,974,735 F924L probably damaging Het
Dpyd G T 3: 118,899,179 C324F probably damaging Het
Eif4b T C 15: 102,082,059 Y33H probably benign Het
Fry C T 5: 150,370,221 Q460* probably null Het
Fryl T C 5: 73,100,465 I665V probably benign Het
Gm9573 A C 17: 35,620,783 probably benign Het
Gpank1 A G 17: 35,123,253 K90E probably damaging Het
Hexdc A G 11: 121,221,562 I482V probably benign Het
Hmcn2 G A 2: 31,336,567 E185K probably damaging Het
Hmcn2 A G 2: 31,458,738 E4922G possibly damaging Het
Ino80d A T 1: 63,058,697 D679E probably benign Het
Kalrn A T 16: 33,987,176 C2608S probably benign Het
Kars T A 8: 112,003,442 probably null Het
Lcn2 A G 2: 32,385,813 V211A possibly damaging Het
Lsmem1 A T 12: 40,180,693 V70E possibly damaging Het
Med12l T C 3: 59,301,377 probably null Het
Megf11 T C 9: 64,506,110 F60L possibly damaging Het
Neb T A 2: 52,210,584 H4438L probably benign Het
Nuf2 C A 1: 169,522,389 V107F probably benign Het
Olfr127 A T 17: 37,903,828 Y94F probably benign Het
Olfr1501 C T 19: 13,838,639 C178Y probably damaging Het
Olfr767 T A 10: 129,079,555 N136I probably benign Het
Pabpn1l A G 8: 122,620,421 V215A probably damaging Het
Pnn A G 12: 59,071,872 I414V probably benign Het
Rab11fip3 A G 17: 26,036,664 Y539H probably damaging Het
Rassf4 A G 6: 116,661,867 V13A probably benign Het
Sephs1 T C 2: 4,884,578 F56L probably benign Het
Sh3rf3 C T 10: 59,131,283 P816S probably benign Het
Skint10 A G 4: 112,711,647 L291P probably damaging Het
Thsd7a T A 6: 12,343,148 I1157L probably benign Het
Tmem184c T C 8: 77,606,407 H85R possibly damaging Het
Tmem94 T C 11: 115,792,428 V679A probably benign Het
Tpcn2 A C 7: 145,257,813 F566V possibly damaging Het
Other mutations in Uqcrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Uqcrc1 APN 9 108948958 missense possibly damaging 0.62
IGL02332:Uqcrc1 APN 9 108947869 missense probably damaging 1.00
IGL02698:Uqcrc1 APN 9 108947943 critical splice donor site probably null
R0313:Uqcrc1 UTSW 9 108948574 missense possibly damaging 0.69
R0743:Uqcrc1 UTSW 9 108944705 nonsense probably null
R2027:Uqcrc1 UTSW 9 108947015 missense probably benign 0.06
R2513:Uqcrc1 UTSW 9 108936768 missense probably damaging 1.00
R4680:Uqcrc1 UTSW 9 108947861 missense probably damaging 1.00
R4993:Uqcrc1 UTSW 9 108944810 missense probably damaging 1.00
R5223:Uqcrc1 UTSW 9 108942156 missense probably damaging 1.00
R5941:Uqcrc1 UTSW 9 108947486 unclassified probably benign
R6274:Uqcrc1 UTSW 9 108942156 missense probably damaging 1.00
R6598:Uqcrc1 UTSW 9 108947622 missense possibly damaging 0.93
R7132:Uqcrc1 UTSW 9 108949468 missense probably damaging 0.98
R7150:Uqcrc1 UTSW 9 108947858 missense probably benign 0.02
R7524:Uqcrc1 UTSW 9 108936759 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TTCTGTTTTCCCAGGAGGCC -3'
(R):5'- TCTGTGGCACATATCCTAAGC -3'

Sequencing Primer
(F):5'- AGCCCTGCCATGTGTTG -3'
(R):5'- GTGGCACATATCCTAAGCTCCATAAC -3'
Posted On2017-01-03