Incidental Mutation 'R5716:Olfr767'
ID 451185
Institutional Source Beutler Lab
Gene Symbol Olfr767
Ensembl Gene ENSMUSG00000059762
Gene Name olfactory receptor 767
Synonyms MOR115-1, GA_x6K02T2PULF-10765431-10764502
MMRRC Submission 043187-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R5716 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 129074825-129082910 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 129079555 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 136 (N136I)
Ref Sequence ENSEMBL: ENSMUSP00000150151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082131] [ENSMUST00000213579]
AlphaFold Q8VG33
Predicted Effect probably benign
Transcript: ENSMUST00000082131
AA Change: N136I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080775
Gene: ENSMUSG00000059762
AA Change: N136I

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.9e-49 PFAM
Pfam:7tm_1 39 288 3.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213579
AA Change: N136I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T C 11: 58,421,768 V24A possibly damaging Het
Abca14 G A 7: 120,246,994 probably null Het
Acad12 A G 5: 121,609,983 V124A probably benign Het
Alg1 A T 16: 5,239,956 D238V probably damaging Het
Bcar3 A G 3: 122,512,915 E179G probably damaging Het
Brf2 A G 8: 27,126,046 S104P probably benign Het
Coq8a A T 1: 180,179,260 Y21N possibly damaging Het
Cramp1l A G 17: 24,974,735 F924L probably damaging Het
Dpyd G T 3: 118,899,179 C324F probably damaging Het
Eif4b T C 15: 102,082,059 Y33H probably benign Het
Fry C T 5: 150,370,221 Q460* probably null Het
Fryl T C 5: 73,100,465 I665V probably benign Het
Gm9573 A C 17: 35,620,783 probably benign Het
Gpank1 A G 17: 35,123,253 K90E probably damaging Het
Hexdc A G 11: 121,221,562 I482V probably benign Het
Hmcn2 G A 2: 31,336,567 E185K probably damaging Het
Hmcn2 A G 2: 31,458,738 E4922G possibly damaging Het
Ino80d A T 1: 63,058,697 D679E probably benign Het
Kalrn A T 16: 33,987,176 C2608S probably benign Het
Kars T A 8: 112,003,442 probably null Het
Lcn2 A G 2: 32,385,813 V211A possibly damaging Het
Lsmem1 A T 12: 40,180,693 V70E possibly damaging Het
Med12l T C 3: 59,301,377 probably null Het
Megf11 T C 9: 64,506,110 F60L possibly damaging Het
Neb T A 2: 52,210,584 H4438L probably benign Het
Nuf2 C A 1: 169,522,389 V107F probably benign Het
Olfr127 A T 17: 37,903,828 Y94F probably benign Het
Olfr1501 C T 19: 13,838,639 C178Y probably damaging Het
Pabpn1l A G 8: 122,620,421 V215A probably damaging Het
Pnn A G 12: 59,071,872 I414V probably benign Het
Rab11fip3 A G 17: 26,036,664 Y539H probably damaging Het
Rassf4 A G 6: 116,661,867 V13A probably benign Het
Sephs1 T C 2: 4,884,578 F56L probably benign Het
Sh3rf3 C T 10: 59,131,283 P816S probably benign Het
Skint10 A G 4: 112,711,647 L291P probably damaging Het
Thsd7a T A 6: 12,343,148 I1157L probably benign Het
Tmem184c T C 8: 77,606,407 H85R possibly damaging Het
Tmem94 T C 11: 115,792,428 V679A probably benign Het
Tpcn2 A C 7: 145,257,813 F566V possibly damaging Het
Uqcrc1 A G 9: 108,947,405 N298D probably benign Het
Other mutations in Olfr767
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Olfr767 APN 10 129079355 missense probably benign 0.13
IGL01945:Olfr767 APN 10 129079303 missense probably damaging 1.00
IGL02341:Olfr767 APN 10 129079461 nonsense probably null
IGL02389:Olfr767 APN 10 129079230 missense probably damaging 0.97
IGL02516:Olfr767 APN 10 129079793 missense possibly damaging 0.95
IGL02755:Olfr767 APN 10 129079196 missense probably benign 0.00
R0145:Olfr767 UTSW 10 129079363 missense probably damaging 0.97
R0453:Olfr767 UTSW 10 129079771 missense probably damaging 0.97
R0578:Olfr767 UTSW 10 129079193 missense probably damaging 1.00
R1034:Olfr767 UTSW 10 129079961 start codon destroyed probably benign 0.43
R1494:Olfr767 UTSW 10 129079615 missense probably damaging 1.00
R1941:Olfr767 UTSW 10 129079954 missense probably damaging 0.99
R3707:Olfr767 UTSW 10 129079385 missense probably benign 0.31
R5405:Olfr767 UTSW 10 129079396 missense probably damaging 0.99
R8224:Olfr767 UTSW 10 129079435 missense possibly damaging 0.90
R9680:Olfr767 UTSW 10 129079489 missense probably benign 0.02
Z1177:Olfr767 UTSW 10 129080052 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- TTACCAGCATTAGAGTCACCAC -3'
(R):5'- CTGGTCAGCATTACAACGGG -3'

Sequencing Primer
(F):5'- GCATTAGAGTCACCACCAGGG -3'
(R):5'- GAAACAAGAGTATTAGCTTTGCTGGC -3'
Posted On 2017-01-03