Incidental Mutation 'R5716:Pnn'
ID451189
Institutional Source Beutler Lab
Gene Symbol Pnn
Ensembl Gene ENSMUSG00000020994
Gene Namepinin
SynonymsD12Ertd512e
MMRRC Submission 043187-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5716 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location59066884-59073998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59071872 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 414 (I414V)
Ref Sequence ENSEMBL: ENSMUSP00000021381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021381] [ENSMUST00000219176]
Predicted Effect probably benign
Transcript: ENSMUST00000021381
AA Change: I414V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000021381
Gene: ENSMUSG00000020994
AA Change: I414V

DomainStartEndE-ValueType
Pfam:Pinin_SDK_N 1 132 3.7e-61 PFAM
Pfam:Pinin_SDK_memA 136 261 7.8e-38 PFAM
coiled coil region 290 374 N/A INTRINSIC
low complexity region 451 508 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
internal_repeat_1 559 572 9.16e-7 PROSPERO
internal_repeat_1 563 576 9.16e-7 PROSPERO
low complexity region 579 647 N/A INTRINSIC
low complexity region 651 665 N/A INTRINSIC
low complexity region 671 682 N/A INTRINSIC
low complexity region 695 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217773
Predicted Effect probably benign
Transcript: ENSMUST00000219176
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die prior to implantation. Mice homozygous for a hypomorphic allele show complete perinatal lethality, edema, axial skeletal abnormalities, cardiac outflow tract defects, cleft palate, and impaired development of the dorsal dermis and brown fat tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T C 11: 58,421,768 V24A possibly damaging Het
Abca14 G A 7: 120,246,994 probably null Het
Acad12 A G 5: 121,609,983 V124A probably benign Het
Alg1 A T 16: 5,239,956 D238V probably damaging Het
Bcar3 A G 3: 122,512,915 E179G probably damaging Het
Brf2 A G 8: 27,126,046 S104P probably benign Het
Coq8a A T 1: 180,179,260 Y21N possibly damaging Het
Cramp1l A G 17: 24,974,735 F924L probably damaging Het
Dpyd G T 3: 118,899,179 C324F probably damaging Het
Eif4b T C 15: 102,082,059 Y33H probably benign Het
Fry C T 5: 150,370,221 Q460* probably null Het
Fryl T C 5: 73,100,465 I665V probably benign Het
Gm9573 A C 17: 35,620,783 probably benign Het
Gpank1 A G 17: 35,123,253 K90E probably damaging Het
Hexdc A G 11: 121,221,562 I482V probably benign Het
Hmcn2 G A 2: 31,336,567 E185K probably damaging Het
Hmcn2 A G 2: 31,458,738 E4922G possibly damaging Het
Ino80d A T 1: 63,058,697 D679E probably benign Het
Kalrn A T 16: 33,987,176 C2608S probably benign Het
Kars T A 8: 112,003,442 probably null Het
Lcn2 A G 2: 32,385,813 V211A possibly damaging Het
Lsmem1 A T 12: 40,180,693 V70E possibly damaging Het
Med12l T C 3: 59,301,377 probably null Het
Megf11 T C 9: 64,506,110 F60L possibly damaging Het
Neb T A 2: 52,210,584 H4438L probably benign Het
Nuf2 C A 1: 169,522,389 V107F probably benign Het
Olfr127 A T 17: 37,903,828 Y94F probably benign Het
Olfr1501 C T 19: 13,838,639 C178Y probably damaging Het
Olfr767 T A 10: 129,079,555 N136I probably benign Het
Pabpn1l A G 8: 122,620,421 V215A probably damaging Het
Rab11fip3 A G 17: 26,036,664 Y539H probably damaging Het
Rassf4 A G 6: 116,661,867 V13A probably benign Het
Sephs1 T C 2: 4,884,578 F56L probably benign Het
Sh3rf3 C T 10: 59,131,283 P816S probably benign Het
Skint10 A G 4: 112,711,647 L291P probably damaging Het
Thsd7a T A 6: 12,343,148 I1157L probably benign Het
Tmem184c T C 8: 77,606,407 H85R possibly damaging Het
Tmem94 T C 11: 115,792,428 V679A probably benign Het
Tpcn2 A C 7: 145,257,813 F566V possibly damaging Het
Uqcrc1 A G 9: 108,947,405 N298D probably benign Het
Other mutations in Pnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02267:Pnn APN 12 59070209 missense probably damaging 1.00
R0350:Pnn UTSW 12 59067117 critical splice donor site probably null
R1853:Pnn UTSW 12 59071613 missense probably damaging 0.99
R1854:Pnn UTSW 12 59071613 missense probably damaging 0.99
R4287:Pnn UTSW 12 59072170 missense possibly damaging 0.86
R4792:Pnn UTSW 12 59072205 missense possibly damaging 0.86
R4812:Pnn UTSW 12 59071618 missense possibly damaging 0.94
R4933:Pnn UTSW 12 59070227 missense probably damaging 1.00
R5541:Pnn UTSW 12 59071930 missense possibly damaging 0.50
R5781:Pnn UTSW 12 59071819 missense probably damaging 0.99
R5963:Pnn UTSW 12 59067831 nonsense probably null
R6877:Pnn UTSW 12 59068767 missense probably damaging 1.00
R6999:Pnn UTSW 12 59070299 critical splice donor site probably null
R7372:Pnn UTSW 12 59068979 missense probably damaging 1.00
R7458:Pnn UTSW 12 59072414 missense unknown
R7535:Pnn UTSW 12 59072137 missense probably benign 0.00
R8171:Pnn UTSW 12 59070437 missense probably damaging 1.00
R8264:Pnn UTSW 12 59072577 missense unknown
Z1177:Pnn UTSW 12 59072799 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCAGGTATAGTTCATAGTGATGCAG -3'
(R):5'- TGGCAAAGTCTCAGGCTGAC -3'

Sequencing Primer
(F):5'- TTCATAGTGATGCAGAGAAAGAAC -3'
(R):5'- TCTCAGGCTGACAGAGAGGC -3'
Posted On2017-01-03