Incidental Mutation 'R5717:Ptgis'
ID451204
Institutional Source Beutler Lab
Gene Symbol Ptgis
Ensembl Gene ENSMUSG00000017969
Gene Nameprostaglandin I2 (prostacyclin) synthase
SynonymsCyp8a1, Pgis, Pgi2
MMRRC Submission 043337-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5717 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location167191805-167240604 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 167208364 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000085357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018113] [ENSMUST00000088041]
Predicted Effect probably benign
Transcript: ENSMUST00000018113
SMART Domains Protein: ENSMUSP00000018113
Gene: ENSMUSG00000017969

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:p450 31 495 8.6e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088041
SMART Domains Protein: ENSMUSP00000085357
Gene: ENSMUSG00000017969

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:p450 31 496 1.9e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136271
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. However, this protein is considered a member of the cytochrome P450 superfamily on the basis of sequence similarity rather than functional similarity. This endoplasmic reticulum membrane protein catalyzes the conversion of prostglandin H2 to prostacyclin (prostaglandin I2), a potent vasodilator and inhibitor of platelet aggregation. An imbalance of prostacyclin and its physiological antagonist thromboxane A2 contribute to the development of myocardial infarction, stroke, and atherosclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased blood urea nitrogen and creatinine levels, thickening of the aorta with age, mildly increased blood pressure, and kidney abnormalities including cysts, fibrosis, necrosis, and renal vascular congestion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik A T 19: 42,053,045 H205L probably benign Het
Acss2 T C 2: 155,561,153 L617S probably damaging Het
Adgrl4 T C 3: 151,492,334 V77A probably benign Het
Adnp2 A G 18: 80,128,264 S977P probably benign Het
Ankrd11 T C 8: 122,892,638 K1492E possibly damaging Het
B4galt5 G A 2: 167,306,629 R190C probably damaging Het
Bbs1 A G 19: 4,897,326 V355A possibly damaging Het
Cenpj GTTTT GTTTTT 14: 56,553,521 probably null Het
Ckap2 T C 8: 22,175,047 E467G probably damaging Het
Cry1 A T 10: 85,146,416 H355Q probably damaging Het
Cspg4 G T 9: 56,885,798 M272I probably benign Het
Dicer1 T A 12: 104,705,128 Y961F probably damaging Het
Dirc2 A G 16: 35,719,429 F341L probably benign Het
Epha2 A T 4: 141,322,071 M689L probably benign Het
Foxc1 C T 13: 31,807,488 A94V probably benign Het
Fras1 T C 5: 96,781,737 V4000A possibly damaging Het
Frmd8 G T 19: 5,873,368 probably benign Het
Gm5218 A G 15: 81,499,277 noncoding transcript Het
Gm7735 T C 16: 89,169,542 L18P unknown Het
Hr C T 14: 70,566,176 T808I probably benign Het
Hyal6 T C 6: 24,743,691 M462T probably benign Het
Igkv6-20 T A 6: 70,336,428 probably benign Het
Igkv8-27 T A 6: 70,171,934 T59S probably benign Het
Itga11 A G 9: 62,752,249 T428A probably benign Het
Klk1b16 A G 7: 44,139,489 I49V probably benign Het
Matn2 G T 15: 34,399,091 E375* probably null Het
Msgn1 T C 12: 11,208,518 Y144C probably damaging Het
Myh1 A G 11: 67,208,956 N564S probably benign Het
Mypn A G 10: 63,127,776 V972A probably damaging Het
Olfr1209 T C 2: 88,910,022 I124V possibly damaging Het
Olfr235 A G 19: 12,269,156 K309E probably benign Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Ppp2r5d A G 17: 46,687,894 S81P probably damaging Het
Ptprr A G 10: 116,048,113 N25S probably benign Het
Rnf123 G A 9: 108,067,424 T456I probably damaging Het
Rpl6l T C 10: 111,126,023 noncoding transcript Het
Rps25 A G 9: 44,408,750 Y23C probably benign Het
Sec24a A G 11: 51,707,210 V879A probably benign Het
Sema6a G A 18: 47,249,263 A739V probably benign Het
Senp6 A T 9: 80,092,312 I4F probably damaging Het
Stoml3 A T 3: 53,505,516 Q197L probably damaging Het
Ttn T A 2: 76,747,747 K24267N probably damaging Het
Vmn1r43 T C 6: 89,869,923 S194G probably damaging Het
Vmn2r17 C T 5: 109,427,274 T149I possibly damaging Het
Wdr72 T A 9: 74,148,205 Y239N probably damaging Het
Zfp423 A T 8: 87,686,559 probably null Het
Zfp759 T A 13: 67,138,708 C114S probably damaging Het
Other mutations in Ptgis
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01562:Ptgis APN 2 167206830 missense probably damaging 1.00
IGL01859:Ptgis APN 2 167214806 critical splice donor site probably null
IGL01965:Ptgis APN 2 167208253 missense probably benign 0.00
IGL02102:Ptgis APN 2 167225447 missense probably damaging 0.99
IGL02296:Ptgis APN 2 167206737 missense probably damaging 1.00
IGL02434:Ptgis APN 2 167240342 critical splice donor site probably null
PIT4142001:Ptgis UTSW 2 167206830 missense probably damaging 1.00
R0332:Ptgis UTSW 2 167214833 missense probably damaging 0.99
R0614:Ptgis UTSW 2 167206882 missense probably damaging 1.00
R1733:Ptgis UTSW 2 167191968 unclassified probably benign
R1756:Ptgis UTSW 2 167206803 missense probably damaging 1.00
R1779:Ptgis UTSW 2 167214858 missense probably benign 0.01
R2004:Ptgis UTSW 2 167214849 missense possibly damaging 0.94
R2019:Ptgis UTSW 2 167208279 missense probably damaging 1.00
R2019:Ptgis UTSW 2 167214810 nonsense probably null
R2512:Ptgis UTSW 2 167207276 missense probably damaging 0.99
R2679:Ptgis UTSW 2 167208193 missense probably benign 0.38
R4962:Ptgis UTSW 2 167225274 critical splice donor site probably null
R5174:Ptgis UTSW 2 167203470 critical splice acceptor site probably null
R5471:Ptgis UTSW 2 167224119 missense probably benign 0.03
R7268:Ptgis UTSW 2 167206756 missense probably benign 0.10
R7513:Ptgis UTSW 2 167225283 missense probably benign 0.00
R7515:Ptgis UTSW 2 167206838 missense possibly damaging 0.91
R7615:Ptgis UTSW 2 167223988 missense probably damaging 1.00
R7736:Ptgis UTSW 2 167191971 missense unknown
R7891:Ptgis UTSW 2 167227514 missense probably damaging 1.00
R7974:Ptgis UTSW 2 167227514 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTTGACCATCCTACCTAGC -3'
(R):5'- TGCCACGAGAGGTCTTCAAG -3'

Sequencing Primer
(F):5'- GCACAGGCATGCTGTCTAGAATC -3'
(R):5'- GTCTTCAAGTAGGTACCAGGCTC -3'
Posted On2017-01-03