Incidental Mutation 'R0550:Srl'
ID 45121
Institutional Source Beutler Lab
Gene Symbol Srl
Ensembl Gene ENSMUSG00000022519
Gene Name sarcalumenin
Synonyms sarcalumenin, 9830004M20Rik, sar
MMRRC Submission 038742-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # R0550 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 4480216-4541816 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4487565 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 101 (W101R)
Ref Sequence ENSEMBL: ENSMUSP00000087986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023161] [ENSMUST00000090500]
AlphaFold Q7TQ48
Predicted Effect probably damaging
Transcript: ENSMUST00000023161
AA Change: W539R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023161
Gene: ENSMUSG00000022519
AA Change: W539R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 111 125 N/A INTRINSIC
low complexity region 129 144 N/A INTRINSIC
low complexity region 283 300 N/A INTRINSIC
low complexity region 348 374 N/A INTRINSIC
low complexity region 379 396 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
Pfam:EHD_N 496 528 1.7e-13 PFAM
Pfam:MMR_HSR1 532 693 1.1e-8 PFAM
Pfam:Dynamin_N 533 694 8.6e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000090500
AA Change: W101R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087986
Gene: ENSMUSG00000022519
AA Change: W101R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MMR_HSR1 94 255 4e-12 PFAM
Pfam:Dynamin_N 95 256 1.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133440
Meta Mutation Damage Score 0.8236 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 99% (76/77)
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit impaired calcium store functions in skeletal and cardiac muscle cells resulting in slow contraction and relaxation phases. Muscle also exhibits enhanced resistance to fatigue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,293,840 Y947N probably damaging Het
Acss3 C A 10: 107,053,471 G163C probably damaging Het
Adcy10 A G 1: 165,565,315 T1367A probably benign Het
Adcy2 A T 13: 68,982,361 S136T probably benign Het
Ahdc1 G A 4: 133,063,037 V530I probably benign Het
Aldh16a1 C T 7: 45,146,229 probably null Het
Ankrd36 T C 11: 5,607,429 probably null Het
Aqr A C 2: 114,132,976 N664K probably damaging Het
Atp6v1c1 T C 15: 38,682,929 probably benign Het
Atp8b2 C T 3: 89,959,061 probably benign Het
Bbx T C 16: 50,274,533 probably benign Het
Bmper T A 9: 23,373,885 D243E probably benign Het
Casz1 GCCACCACCACCACCACCACCAC GCCACCACCACCACCACCAC 4: 148,952,284 probably benign Het
Catsperd T C 17: 56,663,427 probably null Het
Ccdc92b T A 11: 74,629,945 probably null Het
Cd2bp2 G T 7: 127,193,824 T342K probably damaging Het
Clrn3 T A 7: 135,528,425 I27F possibly damaging Het
Cnih3 TTGACGAG T 1: 181,406,477 probably null Het
Cntnap3 T C 13: 64,762,000 T764A possibly damaging Het
Cttnbp2 T G 6: 18,435,309 K183N possibly damaging Het
Cwc27 G A 13: 104,804,949 P155L probably damaging Het
Dcaf10 T C 4: 45,372,753 S389P probably benign Het
Ddx18 T C 1: 121,555,375 K561E probably benign Het
Dkk3 A G 7: 112,158,245 F51L probably damaging Het
Dnaic1 C T 4: 41,596,274 R20* probably null Het
Dr1 G A 5: 108,269,605 G6S probably benign Het
Dync2h1 A T 9: 7,120,954 probably null Het
Eif3l A G 15: 79,076,867 Y16C probably damaging Het
Epb41 A G 4: 131,975,613 I464T probably damaging Het
Erc2 A G 14: 28,271,651 K546E possibly damaging Het
F830045P16Rik T C 2: 129,463,509 D315G probably damaging Het
Fads6 A G 11: 115,296,677 I64T probably benign Het
Fshr T C 17: 89,045,125 N107S probably benign Het
Gbp11 A T 5: 105,343,750 N60K probably benign Het
Gm2a C T 11: 55,103,665 Q54* probably null Het
Hydin A G 8: 110,587,775 D4297G probably benign Het
Il6st G A 13: 112,475,114 probably null Het
Inpp4b T A 8: 81,997,337 H499Q probably benign Het
Kif5c A G 2: 49,758,912 K956R possibly damaging Het
Krt74 G A 15: 101,760,679 noncoding transcript Het
Map3k9 A T 12: 81,725,781 L649Q probably damaging Het
Mdn1 A G 4: 32,730,479 D2871G probably benign Het
Mylk4 T C 13: 32,716,666 T294A probably benign Het
Nbeal2 C T 9: 110,642,158 V252I probably benign Het
Nectin3 A G 16: 46,458,820 I265T possibly damaging Het
Olfr1065 A T 2: 86,445,876 Y35* probably null Het
Olfr1109 G T 2: 87,093,129 H89Q probably benign Het
Olfr1259 A G 2: 89,943,389 I242T probably damaging Het
Olfr1447 A T 19: 12,901,800 probably null Het
Olfr181 A G 16: 58,926,385 F62S probably damaging Het
Olfr554 G A 7: 102,640,950 E235K possibly damaging Het
Olfr910 T A 9: 38,539,380 C162S probably damaging Het
Opn1sw A T 6: 29,380,204 L71Q probably damaging Het
Pced1a G A 2: 130,419,633 P367S probably benign Het
Pkhd1 A T 1: 20,347,223 M2568K probably null Het
Pla2r1 A G 2: 60,425,350 probably null Het
Plpp1 T C 13: 112,834,985 I62T probably benign Het
Polr3g G A 13: 81,694,773 T41I probably damaging Het
Ptch2 T C 4: 117,096,433 probably benign Het
Sema4g A T 19: 44,997,665 H315L probably benign Het
Setd1b G T 5: 123,157,660 S1097I unknown Het
Sfxn4 A G 19: 60,850,945 probably benign Het
Sh3tc1 T C 5: 35,699,784 E1237G probably damaging Het
Slc25a38 A T 9: 120,123,643 N287I probably benign Het
Slc25a48 A G 13: 56,448,998 T31A probably benign Het
Slc6a12 G A 6: 121,356,918 V238I probably damaging Het
Slc8b1 A G 5: 120,531,155 probably benign Het
Slco4c1 A C 1: 96,867,859 V158G probably damaging Het
Sptbn4 T C 7: 27,364,378 T2208A probably benign Het
Srebf1 G A 11: 60,201,676 T843I probably benign Het
St6galnac4 T A 2: 32,594,019 C76* probably null Het
Tdrd3 C A 14: 87,486,220 T290K probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trpm3 A G 19: 22,987,812 E1547G probably damaging Het
Ubn1 A G 16: 5,062,620 probably null Het
Usp10 T A 8: 119,947,801 I456K probably damaging Het
Usp6nl A G 2: 6,400,323 probably benign Het
Vit T A 17: 78,624,793 V443E possibly damaging Het
Whamm G A 7: 81,586,224 V392I possibly damaging Het
Zfhx4 A G 3: 5,400,494 K1904R probably damaging Het
Zfp352 A T 4: 90,224,690 T356S probably damaging Het
Other mutations in Srl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00803:Srl APN 16 4483220 missense probably null 1.00
IGL01296:Srl APN 16 4497682 missense probably damaging 0.99
IGL02006:Srl APN 16 4497286 missense probably benign 0.23
IGL02255:Srl APN 16 4487558 missense probably damaging 1.00
IGL02583:Srl APN 16 4492380 missense possibly damaging 0.69
R0559:Srl UTSW 16 4496978 missense probably benign 0.01
R1933:Srl UTSW 16 4492350 missense probably damaging 0.99
R2093:Srl UTSW 16 4523032 missense unknown
R2298:Srl UTSW 16 4482898 missense probably damaging 1.00
R4093:Srl UTSW 16 4497452 missense possibly damaging 0.93
R4798:Srl UTSW 16 4492358 missense possibly damaging 0.51
R4986:Srl UTSW 16 4496782 missense probably benign 0.00
R5088:Srl UTSW 16 4482769 missense probably damaging 1.00
R5177:Srl UTSW 16 4496403 critical splice donor site probably null
R5260:Srl UTSW 16 4482895 nonsense probably null
R5988:Srl UTSW 16 4523028 missense unknown
R6875:Srl UTSW 16 4482831 missense probably benign 0.02
R6946:Srl UTSW 16 4482559 missense probably benign 0.00
R7221:Srl UTSW 16 4482947 missense probably damaging 0.99
R7262:Srl UTSW 16 4497551 missense probably damaging 0.96
R8307:Srl UTSW 16 4497145 missense probably benign 0.01
R8976:Srl UTSW 16 4483030 missense probably damaging 1.00
R9193:Srl UTSW 16 4493859 missense possibly damaging 0.77
R9424:Srl UTSW 16 4483167 missense probably damaging 1.00
R9576:Srl UTSW 16 4483167 missense probably damaging 1.00
R9785:Srl UTSW 16 4496854 missense probably benign
X0023:Srl UTSW 16 4492368 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCCCGATCTCCCTATAGAAGTTC -3'
(R):5'- AAAGCCCCTGACACAGTTTGATCC -3'

Sequencing Primer
(F):5'- ctcagactacttcatccagcc -3'
(R):5'- TGACACAGTTTGATCCACACAG -3'
Posted On 2013-06-11