Incidental Mutation 'R5717:Klk1b16'
ID451215
Institutional Source Beutler Lab
Gene Symbol Klk1b16
Ensembl Gene ENSMUSG00000038968
Gene Namekallikrein 1-related peptidase b16
SynonymsKlk16, mGk-16
MMRRC Submission 043337-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5717 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44136767-44141610 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44139489 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 49 (I49V)
Ref Sequence ENSEMBL: ENSMUSP00000005933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005933]
Predicted Effect probably benign
Transcript: ENSMUST00000005933
AA Change: I49V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000005933
Gene: ENSMUSG00000038968
AA Change: I49V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 7.64e-80 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206376
Meta Mutation Damage Score 0.1192 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik A T 19: 42,053,045 H205L probably benign Het
Acss2 T C 2: 155,561,153 L617S probably damaging Het
Adgrl4 T C 3: 151,492,334 V77A probably benign Het
Adnp2 A G 18: 80,128,264 S977P probably benign Het
Ankrd11 T C 8: 122,892,638 K1492E possibly damaging Het
B4galt5 G A 2: 167,306,629 R190C probably damaging Het
Bbs1 A G 19: 4,897,326 V355A possibly damaging Het
Cenpj GTTTT GTTTTT 14: 56,553,521 probably null Het
Ckap2 T C 8: 22,175,047 E467G probably damaging Het
Cry1 A T 10: 85,146,416 H355Q probably damaging Het
Cspg4 G T 9: 56,885,798 M272I probably benign Het
Dicer1 T A 12: 104,705,128 Y961F probably damaging Het
Dirc2 A G 16: 35,719,429 F341L probably benign Het
Epha2 A T 4: 141,322,071 M689L probably benign Het
Foxc1 C T 13: 31,807,488 A94V probably benign Het
Fras1 T C 5: 96,781,737 V4000A possibly damaging Het
Frmd8 G T 19: 5,873,368 probably benign Het
Gm5218 A G 15: 81,499,277 noncoding transcript Het
Gm7735 T C 16: 89,169,542 L18P unknown Het
Hr C T 14: 70,566,176 T808I probably benign Het
Hyal6 T C 6: 24,743,691 M462T probably benign Het
Igkv6-20 T A 6: 70,336,428 probably benign Het
Igkv8-27 T A 6: 70,171,934 T59S probably benign Het
Itga11 A G 9: 62,752,249 T428A probably benign Het
Matn2 G T 15: 34,399,091 E375* probably null Het
Msgn1 T C 12: 11,208,518 Y144C probably damaging Het
Myh1 A G 11: 67,208,956 N564S probably benign Het
Mypn A G 10: 63,127,776 V972A probably damaging Het
Olfr1209 T C 2: 88,910,022 I124V possibly damaging Het
Olfr235 A G 19: 12,269,156 K309E probably benign Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Ppp2r5d A G 17: 46,687,894 S81P probably damaging Het
Ptgis C T 2: 167,208,364 probably benign Het
Ptprr A G 10: 116,048,113 N25S probably benign Het
Rnf123 G A 9: 108,067,424 T456I probably damaging Het
Rpl6l T C 10: 111,126,023 noncoding transcript Het
Rps25 A G 9: 44,408,750 Y23C probably benign Het
Sec24a A G 11: 51,707,210 V879A probably benign Het
Sema6a G A 18: 47,249,263 A739V probably benign Het
Senp6 A T 9: 80,092,312 I4F probably damaging Het
Stoml3 A T 3: 53,505,516 Q197L probably damaging Het
Ttn T A 2: 76,747,747 K24267N probably damaging Het
Vmn1r43 T C 6: 89,869,923 S194G probably damaging Het
Vmn2r17 C T 5: 109,427,274 T149I possibly damaging Het
Wdr72 T A 9: 74,148,205 Y239N probably damaging Het
Zfp423 A T 8: 87,686,559 probably null Het
Zfp759 T A 13: 67,138,708 C114S probably damaging Het
Other mutations in Klk1b16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Klk1b16 APN 7 44140678 missense probably damaging 0.98
IGL01529:Klk1b16 APN 7 44140739 missense probably benign 0.18
R1105:Klk1b16 UTSW 7 44139513 missense probably damaging 0.98
R1106:Klk1b16 UTSW 7 44139513 missense probably damaging 0.98
R1559:Klk1b16 UTSW 7 44141001 missense probably benign 0.00
R3883:Klk1b16 UTSW 7 44139463 missense possibly damaging 0.86
R3884:Klk1b16 UTSW 7 44139463 missense possibly damaging 0.86
R4152:Klk1b16 UTSW 7 44140549 missense probably benign 0.09
R4398:Klk1b16 UTSW 7 44141427 missense probably damaging 1.00
R5231:Klk1b16 UTSW 7 44137347 missense probably damaging 1.00
R5389:Klk1b16 UTSW 7 44140988 missense possibly damaging 0.83
R5470:Klk1b16 UTSW 7 44137331 missense probably damaging 0.99
R5532:Klk1b16 UTSW 7 44141526 missense probably benign 0.00
R5690:Klk1b16 UTSW 7 44140894 critical splice acceptor site probably null
R5749:Klk1b16 UTSW 7 44140786 missense probably benign 0.03
R6589:Klk1b16 UTSW 7 44141470 missense probably benign 0.03
R7084:Klk1b16 UTSW 7 44139486 missense probably benign 0.01
R7336:Klk1b16 UTSW 7 44141483 missense probably benign 0.05
X0026:Klk1b16 UTSW 7 44140944 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTATCCAGGACCAGCCATATATTG -3'
(R):5'- GGATAGACTTTCAGCCAGTCCC -3'

Sequencing Primer
(F):5'- AGATCTCCTGGCCACGTC -3'
(R):5'- TTTCAGCCAGTCCCAACCC -3'
Posted On2017-01-03