Incidental Mutation 'R5717:Ckap2'
ID451216
Institutional Source Beutler Lab
Gene Symbol Ckap2
Ensembl Gene ENSMUSG00000037725
Gene Namecytoskeleton associated protein 2
SynonymsLB1
MMRRC Submission 043337-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R5717 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location22168160-22185819 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22175047 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 467 (E467G)
Ref Sequence ENSEMBL: ENSMUSP00000039518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046916]
Predicted Effect probably damaging
Transcript: ENSMUST00000046916
AA Change: E467G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039518
Gene: ENSMUSG00000037725
AA Change: E467G

DomainStartEndE-ValueType
low complexity region 221 234 N/A INTRINSIC
Pfam:CKAP2_C 315 651 3.9e-168 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211629
Meta Mutation Damage Score 0.204 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeleton-associated protein that stabalizes microtubules and plays a role in the regulation of cell division. The encoded protein is itself regulated through phosphorylation at multiple serine and threonine residues. There is a pseudogene of this gene on chromosome 14. Alternative splicing results in multiple transcript variations. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik A T 19: 42,053,045 H205L probably benign Het
Acss2 T C 2: 155,561,153 L617S probably damaging Het
Adgrl4 T C 3: 151,492,334 V77A probably benign Het
Adnp2 A G 18: 80,128,264 S977P probably benign Het
Ankrd11 T C 8: 122,892,638 K1492E possibly damaging Het
B4galt5 G A 2: 167,306,629 R190C probably damaging Het
Bbs1 A G 19: 4,897,326 V355A possibly damaging Het
Cenpj GTTTT GTTTTT 14: 56,553,521 probably null Het
Cry1 A T 10: 85,146,416 H355Q probably damaging Het
Cspg4 G T 9: 56,885,798 M272I probably benign Het
Dicer1 T A 12: 104,705,128 Y961F probably damaging Het
Dirc2 A G 16: 35,719,429 F341L probably benign Het
Epha2 A T 4: 141,322,071 M689L probably benign Het
Foxc1 C T 13: 31,807,488 A94V probably benign Het
Fras1 T C 5: 96,781,737 V4000A possibly damaging Het
Frmd8 G T 19: 5,873,368 probably benign Het
Gm5218 A G 15: 81,499,277 noncoding transcript Het
Gm7735 T C 16: 89,169,542 L18P unknown Het
Hr C T 14: 70,566,176 T808I probably benign Het
Hyal6 T C 6: 24,743,691 M462T probably benign Het
Igkv6-20 T A 6: 70,336,428 probably benign Het
Igkv8-27 T A 6: 70,171,934 T59S probably benign Het
Itga11 A G 9: 62,752,249 T428A probably benign Het
Klk1b16 A G 7: 44,139,489 I49V probably benign Het
Matn2 G T 15: 34,399,091 E375* probably null Het
Msgn1 T C 12: 11,208,518 Y144C probably damaging Het
Myh1 A G 11: 67,208,956 N564S probably benign Het
Mypn A G 10: 63,127,776 V972A probably damaging Het
Olfr1209 T C 2: 88,910,022 I124V possibly damaging Het
Olfr235 A G 19: 12,269,156 K309E probably benign Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Ppp2r5d A G 17: 46,687,894 S81P probably damaging Het
Ptgis C T 2: 167,208,364 probably benign Het
Ptprr A G 10: 116,048,113 N25S probably benign Het
Rnf123 G A 9: 108,067,424 T456I probably damaging Het
Rpl6l T C 10: 111,126,023 noncoding transcript Het
Rps25 A G 9: 44,408,750 Y23C probably benign Het
Sec24a A G 11: 51,707,210 V879A probably benign Het
Sema6a G A 18: 47,249,263 A739V probably benign Het
Senp6 A T 9: 80,092,312 I4F probably damaging Het
Stoml3 A T 3: 53,505,516 Q197L probably damaging Het
Ttn T A 2: 76,747,747 K24267N probably damaging Het
Vmn1r43 T C 6: 89,869,923 S194G probably damaging Het
Vmn2r17 C T 5: 109,427,274 T149I possibly damaging Het
Wdr72 T A 9: 74,148,205 Y239N probably damaging Het
Zfp423 A T 8: 87,686,559 probably null Het
Zfp759 T A 13: 67,138,708 C114S probably damaging Het
Other mutations in Ckap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Ckap2 APN 8 22169758 missense probably damaging 1.00
IGL01519:Ckap2 APN 8 22168898 missense probably benign 0.00
R0530:Ckap2 UTSW 8 22175972 splice site probably benign
R1638:Ckap2 UTSW 8 22175796 missense possibly damaging 0.84
R1965:Ckap2 UTSW 8 22175787 missense possibly damaging 0.95
R2047:Ckap2 UTSW 8 22168747 missense probably benign 0.03
R3023:Ckap2 UTSW 8 22175861 missense possibly damaging 0.95
R3843:Ckap2 UTSW 8 22175758 missense probably damaging 0.98
R4587:Ckap2 UTSW 8 22176976 missense probably benign
R4754:Ckap2 UTSW 8 22168895 missense possibly damaging 0.93
R4847:Ckap2 UTSW 8 22175068 missense probably damaging 0.98
R5354:Ckap2 UTSW 8 22177565 missense probably damaging 0.96
R5423:Ckap2 UTSW 8 22177196 missense probably benign 0.33
R6518:Ckap2 UTSW 8 22173303 missense probably benign 0.41
R7088:Ckap2 UTSW 8 22169866 missense possibly damaging 0.59
R7466:Ckap2 UTSW 8 22177386 missense probably benign 0.02
X0058:Ckap2 UTSW 8 22176798 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTCCTTGCAGCCTTCACTG -3'
(R):5'- GCTGAGTCATGTTTCCAGATCC -3'

Sequencing Primer
(F):5'- GCAGCCTTCACTGTTTCTGCTG -3'
(R):5'- ATGTTTCCAGATCCTTCTGTCAG -3'
Posted On2017-01-03