Incidental Mutation 'R5717:Rpl6l'
ID 451226
Institutional Source Beutler Lab
Gene Symbol Rpl6l
Ensembl Gene ENSMUSG00000091086
Gene Name ribosomal protein L6-like
Synonyms Gm5428
MMRRC Submission 043337-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.914) question?
Stock # R5717 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 110961712-110962582 bp(+) (GRCm39)
Type of Mutation exon
DNA Base Change (assembly) T to C at 110961884 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171120
SMART Domains Protein: ENSMUSP00000131802
Gene: ENSMUSG00000091086

DomainStartEndE-ValueType
Pfam:Ribosomal_L6e_N 43 103 8.9e-37 PFAM
Pfam:Ribosomal_L6e 189 296 6.6e-47 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik A T 19: 42,041,484 (GRCm39) H205L probably benign Het
Acss2 T C 2: 155,403,073 (GRCm39) L617S probably damaging Het
Adgrl4 T C 3: 151,197,971 (GRCm39) V77A probably benign Het
Adnp2 A G 18: 80,171,479 (GRCm39) S977P probably benign Het
Ankrd11 T C 8: 123,619,377 (GRCm39) K1492E possibly damaging Het
B4galt5 G A 2: 167,148,549 (GRCm39) R190C probably damaging Het
Bbs1 A G 19: 4,947,354 (GRCm39) V355A possibly damaging Het
Cenpj GTTTT GTTTTT 14: 56,790,978 (GRCm39) probably null Het
Ckap2 T C 8: 22,665,063 (GRCm39) E467G probably damaging Het
Cry1 A T 10: 84,982,280 (GRCm39) H355Q probably damaging Het
Cspg4 G T 9: 56,793,082 (GRCm39) M272I probably benign Het
Dicer1 T A 12: 104,671,387 (GRCm39) Y961F probably damaging Het
Epha2 A T 4: 141,049,382 (GRCm39) M689L probably benign Het
Foxc1 C T 13: 31,991,471 (GRCm39) A94V probably benign Het
Fras1 T C 5: 96,929,596 (GRCm39) V4000A possibly damaging Het
Frmd8 G T 19: 5,923,396 (GRCm39) probably benign Het
Gm5218 A G 15: 81,383,478 (GRCm39) noncoding transcript Het
Gm7735 T C 16: 88,966,430 (GRCm39) L18P unknown Het
Hr C T 14: 70,803,616 (GRCm39) T808I probably benign Het
Hyal6 T C 6: 24,743,690 (GRCm39) M462T probably benign Het
Igkv6-20 T A 6: 70,313,412 (GRCm39) probably benign Het
Igkv8-27 T A 6: 70,148,918 (GRCm39) T59S probably benign Het
Itga11 A G 9: 62,659,531 (GRCm39) T428A probably benign Het
Klk1b16 A G 7: 43,788,913 (GRCm39) I49V probably benign Het
Matn2 G T 15: 34,399,237 (GRCm39) E375* probably null Het
Msgn1 T C 12: 11,258,519 (GRCm39) Y144C probably damaging Het
Myh1 A G 11: 67,099,782 (GRCm39) N564S probably benign Het
Mypn A G 10: 62,963,555 (GRCm39) V972A probably damaging Het
Or4c29 T C 2: 88,740,366 (GRCm39) I124V possibly damaging Het
Or5an11 A G 19: 12,246,520 (GRCm39) K309E probably benign Het
Or8s5 G A 15: 98,238,246 (GRCm39) A208V probably benign Het
Ppp2r5d A G 17: 46,998,820 (GRCm39) S81P probably damaging Het
Ptgis C T 2: 167,050,284 (GRCm39) probably benign Het
Ptprr A G 10: 115,884,018 (GRCm39) N25S probably benign Het
Rnf123 G A 9: 107,944,623 (GRCm39) T456I probably damaging Het
Rps25 A G 9: 44,320,047 (GRCm39) Y23C probably benign Het
Sec24a A G 11: 51,598,037 (GRCm39) V879A probably benign Het
Sema6a G A 18: 47,382,330 (GRCm39) A739V probably benign Het
Senp6 A T 9: 79,999,594 (GRCm39) I4F probably damaging Het
Slc49a4 A G 16: 35,539,799 (GRCm39) F341L probably benign Het
Stoml3 A T 3: 53,412,937 (GRCm39) Q197L probably damaging Het
Ttn T A 2: 76,578,091 (GRCm39) K24267N probably damaging Het
Vmn1r43 T C 6: 89,846,905 (GRCm39) S194G probably damaging Het
Vmn2r17 C T 5: 109,575,140 (GRCm39) T149I possibly damaging Het
Wdr72 T A 9: 74,055,487 (GRCm39) Y239N probably damaging Het
Zfp423 A T 8: 88,413,187 (GRCm39) probably null Het
Zfp759 T A 13: 67,286,772 (GRCm39) C114S probably damaging Het
Other mutations in Rpl6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3745:Rpl6l UTSW 10 110,962,226 (GRCm39) exon noncoding transcript
R4872:Rpl6l UTSW 10 110,962,304 (GRCm39) exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- CCAAGTTTGGCACCGGTTAG -3'
(R):5'- AGCAGCTTCCGAGGAACATC -3'

Sequencing Primer
(F):5'- CGTGAGCTATACAAGACTGTGTCTC -3'
(R):5'- ACATCTTCGGTGGGATAATACCTAGG -3'
Posted On 2017-01-03