Incidental Mutation 'R0550:Nectin3'
ID45123
Institutional Source Beutler Lab
Gene Symbol Nectin3
Ensembl Gene ENSMUSG00000022656
Gene Namenectin cell adhesion molecule 3
Synonyms3000002N23Rik, 2610301B19Rik, nectin-3, 4921513D19Rik, Pvrl3
MMRRC Submission 038742-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R0550 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location46387706-46498525 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46458820 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 265 (I265T)
Ref Sequence ENSEMBL: ENSMUSP00000093757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023334] [ENSMUST00000023335] [ENSMUST00000096052]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023334
AA Change: I265T

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023334
Gene: ENSMUSG00000022656
AA Change: I265T

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:C2-set_2 173 257 1.5e-19 PFAM
Pfam:Ig_3 284 342 3.1e-6 PFAM
low complexity region 358 367 N/A INTRINSIC
transmembrane domain 404 426 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000023335
AA Change: I265T

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023335
Gene: ENSMUSG00000022656
AA Change: I265T

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:C2-set_2 173 257 2.5e-19 PFAM
Pfam:Ig_2 281 355 1.3e-6 PFAM
transmembrane domain 368 390 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000096052
AA Change: I265T

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093757
Gene: ENSMUSG00000022656
AA Change: I265T

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:C2-set_2 173 257 2e-19 PFAM
Pfam:Ig_2 281 355 1e-6 PFAM
transmembrane domain 368 390 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133935
Predicted Effect probably benign
Transcript: ENSMUST00000149901
SMART Domains Protein: ENSMUSP00000117479
Gene: ENSMUSG00000022656

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:Ig_3 184 243 4.8e-5 PFAM
Meta Mutation Damage Score 0.4121 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nectin family of proteins, which function as adhesion molecules at adherens junctions. This family member interacts with other nectin-like proteins and with afadin, a filamentous actin-binding protein involved in the regulation of directional motility, cell proliferation and survival. This gene plays a role in ocular development involving the ciliary body. Mutations in this gene are believed to result in congenital ocular defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice exhibit male infertility and eye abnormalities including microphthalmia, absent vitreous body, abnormal ciliary body, retinal layers, and lenses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,293,840 Y947N probably damaging Het
Acss3 C A 10: 107,053,471 G163C probably damaging Het
Adcy10 A G 1: 165,565,315 T1367A probably benign Het
Adcy2 A T 13: 68,982,361 S136T probably benign Het
Ahdc1 G A 4: 133,063,037 V530I probably benign Het
Aldh16a1 C T 7: 45,146,229 probably null Het
Ankrd36 T C 11: 5,607,429 probably null Het
Aqr A C 2: 114,132,976 N664K probably damaging Het
Atp6v1c1 T C 15: 38,682,929 probably benign Het
Atp8b2 C T 3: 89,959,061 probably benign Het
Bbx T C 16: 50,274,533 probably benign Het
Bmper T A 9: 23,373,885 D243E probably benign Het
Casz1 GCCACCACCACCACCACCACCAC GCCACCACCACCACCACCAC 4: 148,952,284 probably benign Het
Catsperd T C 17: 56,663,427 probably null Het
Ccdc92b T A 11: 74,629,945 probably null Het
Cd2bp2 G T 7: 127,193,824 T342K probably damaging Het
Clrn3 T A 7: 135,528,425 I27F possibly damaging Het
Cnih3 TTGACGAG T 1: 181,406,477 probably null Het
Cntnap3 T C 13: 64,762,000 T764A possibly damaging Het
Cttnbp2 T G 6: 18,435,309 K183N possibly damaging Het
Cwc27 G A 13: 104,804,949 P155L probably damaging Het
Dcaf10 T C 4: 45,372,753 S389P probably benign Het
Ddx18 T C 1: 121,555,375 K561E probably benign Het
Dkk3 A G 7: 112,158,245 F51L probably damaging Het
Dnaic1 C T 4: 41,596,274 R20* probably null Het
Dr1 G A 5: 108,269,605 G6S probably benign Het
Dync2h1 A T 9: 7,120,954 probably null Het
Eif3l A G 15: 79,076,867 Y16C probably damaging Het
Epb41 A G 4: 131,975,613 I464T probably damaging Het
Erc2 A G 14: 28,271,651 K546E possibly damaging Het
F830045P16Rik T C 2: 129,463,509 D315G probably damaging Het
Fads6 A G 11: 115,296,677 I64T probably benign Het
Fshr T C 17: 89,045,125 N107S probably benign Het
Gbp11 A T 5: 105,343,750 N60K probably benign Het
Gm2a C T 11: 55,103,665 Q54* probably null Het
Hydin A G 8: 110,587,775 D4297G probably benign Het
Il6st G A 13: 112,475,114 probably null Het
Inpp4b T A 8: 81,997,337 H499Q probably benign Het
Kif5c A G 2: 49,758,912 K956R possibly damaging Het
Krt74 G A 15: 101,760,679 noncoding transcript Het
Map3k9 A T 12: 81,725,781 L649Q probably damaging Het
Mdn1 A G 4: 32,730,479 D2871G probably benign Het
Mylk4 T C 13: 32,716,666 T294A probably benign Het
Nbeal2 C T 9: 110,642,158 V252I probably benign Het
Olfr1065 A T 2: 86,445,876 Y35* probably null Het
Olfr1109 G T 2: 87,093,129 H89Q probably benign Het
Olfr1259 A G 2: 89,943,389 I242T probably damaging Het
Olfr1447 A T 19: 12,901,800 probably null Het
Olfr181 A G 16: 58,926,385 F62S probably damaging Het
Olfr554 G A 7: 102,640,950 E235K possibly damaging Het
Olfr910 T A 9: 38,539,380 C162S probably damaging Het
Opn1sw A T 6: 29,380,204 L71Q probably damaging Het
Pced1a G A 2: 130,419,633 P367S probably benign Het
Pkhd1 A T 1: 20,347,223 M2568K probably null Het
Pla2r1 A G 2: 60,425,350 probably null Het
Plpp1 T C 13: 112,834,985 I62T probably benign Het
Polr3g G A 13: 81,694,773 T41I probably damaging Het
Ptch2 T C 4: 117,096,433 probably benign Het
Sema4g A T 19: 44,997,665 H315L probably benign Het
Setd1b G T 5: 123,157,660 S1097I unknown Het
Sfxn4 A G 19: 60,850,945 probably benign Het
Sh3tc1 T C 5: 35,699,784 E1237G probably damaging Het
Slc25a38 A T 9: 120,123,643 N287I probably benign Het
Slc25a48 A G 13: 56,448,998 T31A probably benign Het
Slc6a12 G A 6: 121,356,918 V238I probably damaging Het
Slc8b1 A G 5: 120,531,155 probably benign Het
Slco4c1 A C 1: 96,867,859 V158G probably damaging Het
Sptbn4 T C 7: 27,364,378 T2208A probably benign Het
Srebf1 G A 11: 60,201,676 T843I probably benign Het
Srl A G 16: 4,487,565 W101R probably damaging Het
St6galnac4 T A 2: 32,594,019 C76* probably null Het
Tdrd3 C A 14: 87,486,220 T290K probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trpm3 A G 19: 22,987,812 E1547G probably damaging Het
Ubn1 A G 16: 5,062,620 probably null Het
Usp10 T A 8: 119,947,801 I456K probably damaging Het
Usp6nl A G 2: 6,400,323 probably benign Het
Vit T A 17: 78,624,793 V443E possibly damaging Het
Whamm G A 7: 81,586,224 V392I possibly damaging Het
Zfhx4 A G 3: 5,400,494 K1904R probably damaging Het
Zfp352 A T 4: 90,224,690 T356S probably damaging Het
Other mutations in Nectin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Nectin3 APN 16 46458853 missense probably benign 0.23
R0373:Nectin3 UTSW 16 46458187 missense probably damaging 0.99
R1219:Nectin3 UTSW 16 46454679 nonsense probably null
R1251:Nectin3 UTSW 16 46463842 missense possibly damaging 0.82
R1398:Nectin3 UTSW 16 46448756 missense possibly damaging 0.95
R1439:Nectin3 UTSW 16 46448394 nonsense probably null
R2250:Nectin3 UTSW 16 46454736 missense probably benign 0.00
R2448:Nectin3 UTSW 16 46448515 splice site probably null
R2483:Nectin3 UTSW 16 46395179 missense possibly damaging 0.83
R4523:Nectin3 UTSW 16 46448590 missense probably benign 0.15
R4709:Nectin3 UTSW 16 46463943 missense possibly damaging 0.58
R4809:Nectin3 UTSW 16 46448160 intron probably benign
R4884:Nectin3 UTSW 16 46448886 missense probably benign 0.01
R5051:Nectin3 UTSW 16 46448550 missense possibly damaging 0.95
R5061:Nectin3 UTSW 16 46448449 missense probably benign 0.03
R5272:Nectin3 UTSW 16 46448476 missense possibly damaging 0.82
R5365:Nectin3 UTSW 16 46464106 nonsense probably null
R5768:Nectin3 UTSW 16 46458817 missense probably damaging 0.98
R5987:Nectin3 UTSW 16 46464145 missense probably benign 0.00
R6029:Nectin3 UTSW 16 46436400 missense probably benign 0.08
R6131:Nectin3 UTSW 16 46395152 missense probably damaging 0.98
R6251:Nectin3 UTSW 16 46395150 missense probably damaging 0.99
R6299:Nectin3 UTSW 16 46463982 missense probably damaging 0.98
R6347:Nectin3 UTSW 16 46458124 missense probably benign 0.01
R6360:Nectin3 UTSW 16 46411109 missense probably benign 0.09
R6505:Nectin3 UTSW 16 46448821 missense possibly damaging 0.68
R6703:Nectin3 UTSW 16 46463842 missense probably damaging 0.99
R6869:Nectin3 UTSW 16 46395143 missense probably damaging 0.96
R7184:Nectin3 UTSW 16 46395121 missense possibly damaging 0.66
R7298:Nectin3 UTSW 16 46448396 missense probably damaging 1.00
R7455:Nectin3 UTSW 16 46496742 nonsense probably null
R7973:Nectin3 UTSW 16 46396121 missense probably benign 0.13
R7993:Nectin3 UTSW 16 46458821 missense probably benign 0.01
R8108:Nectin3 UTSW 16 46464121 missense possibly damaging 0.84
R8259:Nectin3 UTSW 16 46436391 missense probably benign 0.00
R8511:Nectin3 UTSW 16 46464000 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGCATAATCACTCGGGAAGGC -3'
(R):5'- CAGTCGCACAGATTGACTGGGAAG -3'

Sequencing Primer
(F):5'- TCACTCGGGAAGGCAATATTC -3'
(R):5'- AGGTGATCTTGGTGAAATGGAATC -3'
Posted On2013-06-11