Incidental Mutation 'R0550:Nectin3'
ID 45123
Institutional Source Beutler Lab
Gene Symbol Nectin3
Ensembl Gene ENSMUSG00000022656
Gene Name nectin cell adhesion molecule 3
Synonyms 2610301B19Rik, nectin-3, 3000002N23Rik, Pvrl3, 4921513D19Rik
MMRRC Submission 038742-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.269) question?
Stock # R0550 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 46208069-46318888 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46279183 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 265 (I265T)
Ref Sequence ENSEMBL: ENSMUSP00000093757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023334] [ENSMUST00000023335] [ENSMUST00000096052]
AlphaFold Q9JLB9
Predicted Effect possibly damaging
Transcript: ENSMUST00000023334
AA Change: I265T

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023334
Gene: ENSMUSG00000022656
AA Change: I265T

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:C2-set_2 173 257 1.5e-19 PFAM
Pfam:Ig_3 284 342 3.1e-6 PFAM
low complexity region 358 367 N/A INTRINSIC
transmembrane domain 404 426 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000023335
AA Change: I265T

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023335
Gene: ENSMUSG00000022656
AA Change: I265T

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:C2-set_2 173 257 2.5e-19 PFAM
Pfam:Ig_2 281 355 1.3e-6 PFAM
transmembrane domain 368 390 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000096052
AA Change: I265T

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093757
Gene: ENSMUSG00000022656
AA Change: I265T

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:C2-set_2 173 257 2e-19 PFAM
Pfam:Ig_2 281 355 1e-6 PFAM
transmembrane domain 368 390 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133935
Predicted Effect probably benign
Transcript: ENSMUST00000149901
SMART Domains Protein: ENSMUSP00000117479
Gene: ENSMUSG00000022656

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:Ig_3 184 243 4.8e-5 PFAM
Meta Mutation Damage Score 0.4121 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nectin family of proteins, which function as adhesion molecules at adherens junctions. This family member interacts with other nectin-like proteins and with afadin, a filamentous actin-binding protein involved in the regulation of directional motility, cell proliferation and survival. This gene plays a role in ocular development involving the ciliary body. Mutations in this gene are believed to result in congenital ocular defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice exhibit male infertility and eye abnormalities including microphthalmia, absent vitreous body, abnormal ciliary body, retinal layers, and lenses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,184,666 (GRCm39) Y947N probably damaging Het
Acss3 C A 10: 106,889,332 (GRCm39) G163C probably damaging Het
Adcy10 A G 1: 165,392,884 (GRCm39) T1367A probably benign Het
Adcy2 A T 13: 69,130,480 (GRCm39) S136T probably benign Het
Ahdc1 G A 4: 132,790,348 (GRCm39) V530I probably benign Het
Aldh16a1 C T 7: 44,795,653 (GRCm39) probably null Het
Ankrd36 T C 11: 5,557,429 (GRCm39) probably null Het
Aqr A C 2: 113,963,457 (GRCm39) N664K probably damaging Het
Atp6v1c1 T C 15: 38,683,173 (GRCm39) probably benign Het
Atp8b2 C T 3: 89,866,368 (GRCm39) probably benign Het
Bbx T C 16: 50,094,896 (GRCm39) probably benign Het
Bmper T A 9: 23,285,181 (GRCm39) D243E probably benign Het
Casz1 GCCACCACCACCACCACCACCAC GCCACCACCACCACCACCAC 4: 149,036,741 (GRCm39) probably benign Het
Catsperd T C 17: 56,970,427 (GRCm39) probably null Het
Ccdc92b T A 11: 74,520,771 (GRCm39) probably null Het
Cd2bp2 G T 7: 126,792,996 (GRCm39) T342K probably damaging Het
Clrn3 T A 7: 135,130,154 (GRCm39) I27F possibly damaging Het
Cnih3 TTGACGAG T 1: 181,234,042 (GRCm39) probably null Het
Cntnap3 T C 13: 64,909,814 (GRCm39) T764A possibly damaging Het
Cttnbp2 T G 6: 18,435,308 (GRCm39) K183N possibly damaging Het
Cwc27 G A 13: 104,941,457 (GRCm39) P155L probably damaging Het
Dcaf10 T C 4: 45,372,753 (GRCm39) S389P probably benign Het
Ddx18 T C 1: 121,483,104 (GRCm39) K561E probably benign Het
Dkk3 A G 7: 111,757,452 (GRCm39) F51L probably damaging Het
Dnai1 C T 4: 41,596,274 (GRCm39) R20* probably null Het
Dr1 G A 5: 108,417,471 (GRCm39) G6S probably benign Het
Dync2h1 A T 9: 7,120,954 (GRCm39) probably null Het
Eif3l A G 15: 78,961,067 (GRCm39) Y16C probably damaging Het
Epb41 A G 4: 131,702,924 (GRCm39) I464T probably damaging Het
Erc2 A G 14: 27,993,608 (GRCm39) K546E possibly damaging Het
F830045P16Rik T C 2: 129,305,429 (GRCm39) D315G probably damaging Het
Fads6 A G 11: 115,187,503 (GRCm39) I64T probably benign Het
Fshr T C 17: 89,352,553 (GRCm39) N107S probably benign Het
Gbp11 A T 5: 105,491,616 (GRCm39) N60K probably benign Het
Gm2a C T 11: 54,994,491 (GRCm39) Q54* probably null Het
Hydin A G 8: 111,314,407 (GRCm39) D4297G probably benign Het
Il6st G A 13: 112,611,648 (GRCm39) probably null Het
Inpp4b T A 8: 82,723,966 (GRCm39) H499Q probably benign Het
Kif5c A G 2: 49,648,924 (GRCm39) K956R possibly damaging Het
Krt74 G A 15: 101,669,114 (GRCm39) noncoding transcript Het
Map3k9 A T 12: 81,772,555 (GRCm39) L649Q probably damaging Het
Mdn1 A G 4: 32,730,479 (GRCm39) D2871G probably benign Het
Mylk4 T C 13: 32,900,649 (GRCm39) T294A probably benign Het
Nbeal2 C T 9: 110,471,226 (GRCm39) V252I probably benign Het
Opn1sw A T 6: 29,380,203 (GRCm39) L71Q probably damaging Het
Or4c12 A G 2: 89,773,733 (GRCm39) I242T probably damaging Het
Or52m1 G A 7: 102,290,157 (GRCm39) E235K possibly damaging Het
Or5aq6 G T 2: 86,923,473 (GRCm39) H89Q probably benign Het
Or5b97 A T 19: 12,879,164 (GRCm39) probably null Het
Or5k17 A G 16: 58,746,748 (GRCm39) F62S probably damaging Het
Or8b46 T A 9: 38,450,676 (GRCm39) C162S probably damaging Het
Or8k27 A T 2: 86,276,220 (GRCm39) Y35* probably null Het
Pced1a G A 2: 130,261,553 (GRCm39) P367S probably benign Het
Pkhd1 A T 1: 20,417,447 (GRCm39) M2568K probably null Het
Pla2r1 A G 2: 60,255,694 (GRCm39) probably null Het
Plpp1 T C 13: 112,971,519 (GRCm39) I62T probably benign Het
Polr3g G A 13: 81,842,892 (GRCm39) T41I probably damaging Het
Ptch2 T C 4: 116,953,630 (GRCm39) probably benign Het
Sema4g A T 19: 44,986,104 (GRCm39) H315L probably benign Het
Setd1b G T 5: 123,295,723 (GRCm39) S1097I unknown Het
Sfxn4 A G 19: 60,839,383 (GRCm39) probably benign Het
Sh3tc1 T C 5: 35,857,128 (GRCm39) E1237G probably damaging Het
Slc25a38 A T 9: 119,952,709 (GRCm39) N287I probably benign Het
Slc25a48 A G 13: 56,596,811 (GRCm39) T31A probably benign Het
Slc6a12 G A 6: 121,333,877 (GRCm39) V238I probably damaging Het
Slc8b1 A G 5: 120,669,220 (GRCm39) probably benign Het
Slco4c1 A C 1: 96,795,584 (GRCm39) V158G probably damaging Het
Sptbn4 T C 7: 27,063,803 (GRCm39) T2208A probably benign Het
Srebf1 G A 11: 60,092,502 (GRCm39) T843I probably benign Het
Srl A G 16: 4,305,429 (GRCm39) W101R probably damaging Het
St6galnac4 T A 2: 32,484,031 (GRCm39) C76* probably null Het
Tdrd3 C A 14: 87,723,656 (GRCm39) T290K probably damaging Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Trpm3 A G 19: 22,965,176 (GRCm39) E1547G probably damaging Het
Ubn1 A G 16: 4,880,484 (GRCm39) probably null Het
Usp10 T A 8: 120,674,540 (GRCm39) I456K probably damaging Het
Usp6nl A G 2: 6,405,134 (GRCm39) probably benign Het
Vit T A 17: 78,932,222 (GRCm39) V443E possibly damaging Het
Whamm G A 7: 81,235,972 (GRCm39) V392I possibly damaging Het
Zfhx4 A G 3: 5,465,554 (GRCm39) K1904R probably damaging Het
Zfp352 A T 4: 90,112,927 (GRCm39) T356S probably damaging Het
Other mutations in Nectin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Nectin3 APN 16 46,279,216 (GRCm39) missense probably benign 0.23
R0373:Nectin3 UTSW 16 46,278,550 (GRCm39) missense probably damaging 0.99
R1219:Nectin3 UTSW 16 46,275,042 (GRCm39) nonsense probably null
R1251:Nectin3 UTSW 16 46,284,205 (GRCm39) missense possibly damaging 0.82
R1398:Nectin3 UTSW 16 46,269,119 (GRCm39) missense possibly damaging 0.95
R1439:Nectin3 UTSW 16 46,268,757 (GRCm39) nonsense probably null
R2250:Nectin3 UTSW 16 46,275,099 (GRCm39) missense probably benign 0.00
R2448:Nectin3 UTSW 16 46,268,878 (GRCm39) splice site probably null
R2483:Nectin3 UTSW 16 46,215,542 (GRCm39) missense possibly damaging 0.83
R4523:Nectin3 UTSW 16 46,268,953 (GRCm39) missense probably benign 0.15
R4709:Nectin3 UTSW 16 46,284,306 (GRCm39) missense possibly damaging 0.58
R4809:Nectin3 UTSW 16 46,268,523 (GRCm39) intron probably benign
R4884:Nectin3 UTSW 16 46,269,249 (GRCm39) missense probably benign 0.01
R5051:Nectin3 UTSW 16 46,268,913 (GRCm39) missense possibly damaging 0.95
R5061:Nectin3 UTSW 16 46,268,812 (GRCm39) missense probably benign 0.03
R5272:Nectin3 UTSW 16 46,268,839 (GRCm39) missense possibly damaging 0.82
R5365:Nectin3 UTSW 16 46,284,469 (GRCm39) nonsense probably null
R5768:Nectin3 UTSW 16 46,279,180 (GRCm39) missense probably damaging 0.98
R5987:Nectin3 UTSW 16 46,284,508 (GRCm39) missense probably benign 0.00
R6029:Nectin3 UTSW 16 46,256,763 (GRCm39) missense probably benign 0.08
R6131:Nectin3 UTSW 16 46,215,515 (GRCm39) missense probably damaging 0.98
R6251:Nectin3 UTSW 16 46,215,513 (GRCm39) missense probably damaging 0.99
R6299:Nectin3 UTSW 16 46,284,345 (GRCm39) missense probably damaging 0.98
R6347:Nectin3 UTSW 16 46,278,487 (GRCm39) missense probably benign 0.01
R6360:Nectin3 UTSW 16 46,231,472 (GRCm39) missense probably benign 0.09
R6505:Nectin3 UTSW 16 46,269,184 (GRCm39) missense possibly damaging 0.68
R6703:Nectin3 UTSW 16 46,284,205 (GRCm39) missense probably damaging 0.99
R6869:Nectin3 UTSW 16 46,215,506 (GRCm39) missense probably damaging 0.96
R7184:Nectin3 UTSW 16 46,215,484 (GRCm39) missense possibly damaging 0.66
R7298:Nectin3 UTSW 16 46,268,759 (GRCm39) missense probably damaging 1.00
R7455:Nectin3 UTSW 16 46,317,105 (GRCm39) nonsense probably null
R7973:Nectin3 UTSW 16 46,216,484 (GRCm39) missense probably benign 0.13
R7993:Nectin3 UTSW 16 46,279,184 (GRCm39) missense probably benign 0.01
R8108:Nectin3 UTSW 16 46,284,484 (GRCm39) missense possibly damaging 0.84
R8259:Nectin3 UTSW 16 46,256,754 (GRCm39) missense probably benign 0.00
R8511:Nectin3 UTSW 16 46,284,363 (GRCm39) missense probably damaging 1.00
R8971:Nectin3 UTSW 16 46,269,265 (GRCm39) missense probably benign
R9195:Nectin3 UTSW 16 46,279,259 (GRCm39) nonsense probably null
R9264:Nectin3 UTSW 16 46,274,998 (GRCm39) missense probably damaging 1.00
R9492:Nectin3 UTSW 16 46,215,511 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCAGCATAATCACTCGGGAAGGC -3'
(R):5'- CAGTCGCACAGATTGACTGGGAAG -3'

Sequencing Primer
(F):5'- TCACTCGGGAAGGCAATATTC -3'
(R):5'- AGGTGATCTTGGTGAAATGGAATC -3'
Posted On 2013-06-11