Mutagenetix > Incidental Mutation

Incidental Mutation 'R0550:Nectin3'

45123

Institutional Source

Beutler Lab

Gene Symbol

Nectin3

Ensembl Gene

ENSMUSG00000022656

Gene Name

nectin cell adhesion molecule 3

Synonyms

3000002N23Rik, 2610301B19Rik, nectin-3, 4921513D19Rik, Pvrl3

MMRRC Submission

038742-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.259) question?

Stock #

R0550 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46387706-46498525 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 46458820 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 265 (I265T)

Ref Sequence

ENSEMBL: ENSMUSP00000093757 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023334] [ENSMUST00000023335] [ENSMUST00000096052]

AlphaFold

Q9JLB9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000023334
AA Change: I265T

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000023334
Gene: ENSMUSG00000022656
AA Change: I265T

Domain	Start	End	E-Value	Type
low complexity region	24	48	N/A	INTRINSIC
IG	63	167	5.04e-9	SMART
Pfam:C2-set_2	173	257	1.5e-19	PFAM
Pfam:Ig_3	284	342	3.1e-6	PFAM
low complexity region	358	367	N/A	INTRINSIC
transmembrane domain	404	426	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000023335
AA Change: I265T

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000023335
Gene: ENSMUSG00000022656
AA Change: I265T

Domain	Start	End	E-Value	Type
low complexity region	24	48	N/A	INTRINSIC
IG	63	167	5.04e-9	SMART
Pfam:C2-set_2	173	257	2.5e-19	PFAM
Pfam:Ig_2	281	355	1.3e-6	PFAM
transmembrane domain	368	390	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000096052
AA Change: I265T

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000093757
Gene: ENSMUSG00000022656
AA Change: I265T

Domain	Start	End	E-Value	Type
low complexity region	24	48	N/A	INTRINSIC
IG	63	167	5.04e-9	SMART
Pfam:C2-set_2	173	257	2e-19	PFAM
Pfam:Ig_2	281	355	1e-6	PFAM
transmembrane domain	368	390	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133935

Predicted Effect

probably benign
Transcript: ENSMUST00000149901

SMART Domains

Protein: ENSMUSP00000117479
Gene: ENSMUSG00000022656

Domain	Start	End	E-Value	Type
low complexity region	24	48	N/A	INTRINSIC
IG	63	167	5.04e-9	SMART
Pfam:Ig_3	184	243	4.8e-5	PFAM

Meta Mutation Damage Score

0.4121

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 97.0%
20x: 94.2%

Validation Efficiency

99% (76/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nectin family of proteins, which function as adhesion molecules at adherens junctions. This family member interacts with other nectin-like proteins and with afadin, a filamentous actin-binding protein involved in the regulation of directional motility, cell proliferation and survival. This gene plays a role in ocular development involving the ciliary body. Mutations in this gene are believed to result in congenital ocular defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice exhibit male infertility and eye abnormalities including microphthalmia, absent vitreous body, abnormal ciliary body, retinal layers, and lenses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	T	11: 110,293,840	Y947N	probably damaging	Het
Acss3	C	A	10: 107,053,471	G163C	probably damaging	Het
Adcy10	A	G	1: 165,565,315	T1367A	probably benign	Het
Adcy2	A	T	13: 68,982,361	S136T	probably benign	Het
Ahdc1	G	A	4: 133,063,037	V530I	probably benign	Het
Aldh16a1	C	T	7: 45,146,229		probably null	Het
Ankrd36	T	C	11: 5,607,429		probably null	Het
Aqr	A	C	2: 114,132,976	N664K	probably damaging	Het
Atp6v1c1	T	C	15: 38,682,929		probably benign	Het
Atp8b2	C	T	3: 89,959,061		probably benign	Het
Bbx	T	C	16: 50,274,533		probably benign	Het
Bmper	T	A	9: 23,373,885	D243E	probably benign	Het
Casz1	GCCACCACCACCACCACCACCAC	GCCACCACCACCACCACCAC	4: 148,952,284		probably benign	Het
Catsperd	T	C	17: 56,663,427		probably null	Het
Ccdc92b	T	A	11: 74,629,945		probably null	Het
Cd2bp2	G	T	7: 127,193,824	T342K	probably damaging	Het
Clrn3	T	A	7: 135,528,425	I27F	possibly damaging	Het
Cnih3	TTGACGAG	T	1: 181,406,477		probably null	Het
Cntnap3	T	C	13: 64,762,000	T764A	possibly damaging	Het
Cttnbp2	T	G	6: 18,435,309	K183N	possibly damaging	Het
Cwc27	G	A	13: 104,804,949	P155L	probably damaging	Het
Dcaf10	T	C	4: 45,372,753	S389P	probably benign	Het
Ddx18	T	C	1: 121,555,375	K561E	probably benign	Het
Dkk3	A	G	7: 112,158,245	F51L	probably damaging	Het
Dnaic1	C	T	4: 41,596,274	R20*	probably null	Het
Dr1	G	A	5: 108,269,605	G6S	probably benign	Het
Dync2h1	A	T	9: 7,120,954		probably null	Het
Eif3l	A	G	15: 79,076,867	Y16C	probably damaging	Het
Epb41	A	G	4: 131,975,613	I464T	probably damaging	Het
Erc2	A	G	14: 28,271,651	K546E	possibly damaging	Het
F830045P16Rik	T	C	2: 129,463,509	D315G	probably damaging	Het
Fads6	A	G	11: 115,296,677	I64T	probably benign	Het
Fshr	T	C	17: 89,045,125	N107S	probably benign	Het
Gbp11	A	T	5: 105,343,750	N60K	probably benign	Het
Gm2a	C	T	11: 55,103,665	Q54*	probably null	Het
Hydin	A	G	8: 110,587,775	D4297G	probably benign	Het
Il6st	G	A	13: 112,475,114		probably null	Het
Inpp4b	T	A	8: 81,997,337	H499Q	probably benign	Het
Kif5c	A	G	2: 49,758,912	K956R	possibly damaging	Het
Krt74	G	A	15: 101,760,679		noncoding transcript	Het
Map3k9	A	T	12: 81,725,781	L649Q	probably damaging	Het
Mdn1	A	G	4: 32,730,479	D2871G	probably benign	Het
Mylk4	T	C	13: 32,716,666	T294A	probably benign	Het
Nbeal2	C	T	9: 110,642,158	V252I	probably benign	Het
Olfr1065	A	T	2: 86,445,876	Y35*	probably null	Het
Olfr1109	G	T	2: 87,093,129	H89Q	probably benign	Het
Olfr1259	A	G	2: 89,943,389	I242T	probably damaging	Het
Olfr1447	A	T	19: 12,901,800		probably null	Het
Olfr181	A	G	16: 58,926,385	F62S	probably damaging	Het
Olfr554	G	A	7: 102,640,950	E235K	possibly damaging	Het
Olfr910	T	A	9: 38,539,380	C162S	probably damaging	Het
Opn1sw	A	T	6: 29,380,204	L71Q	probably damaging	Het
Pced1a	G	A	2: 130,419,633	P367S	probably benign	Het
Pkhd1	A	T	1: 20,347,223	M2568K	probably null	Het
Pla2r1	A	G	2: 60,425,350		probably null	Het
Plpp1	T	C	13: 112,834,985	I62T	probably benign	Het
Polr3g	G	A	13: 81,694,773	T41I	probably damaging	Het
Ptch2	T	C	4: 117,096,433		probably benign	Het
Sema4g	A	T	19: 44,997,665	H315L	probably benign	Het
Setd1b	G	T	5: 123,157,660	S1097I	unknown	Het
Sfxn4	A	G	19: 60,850,945		probably benign	Het
Sh3tc1	T	C	5: 35,699,784	E1237G	probably damaging	Het
Slc25a38	A	T	9: 120,123,643	N287I	probably benign	Het
Slc25a48	A	G	13: 56,448,998	T31A	probably benign	Het
Slc6a12	G	A	6: 121,356,918	V238I	probably damaging	Het
Slc8b1	A	G	5: 120,531,155		probably benign	Het
Slco4c1	A	C	1: 96,867,859	V158G	probably damaging	Het
Sptbn4	T	C	7: 27,364,378	T2208A	probably benign	Het
Srebf1	G	A	11: 60,201,676	T843I	probably benign	Het
Srl	A	G	16: 4,487,565	W101R	probably damaging	Het
St6galnac4	T	A	2: 32,594,019	C76*	probably null	Het
Tdrd3	C	A	14: 87,486,220	T290K	probably damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Trpm3	A	G	19: 22,987,812	E1547G	probably damaging	Het
Ubn1	A	G	16: 5,062,620		probably null	Het
Usp10	T	A	8: 119,947,801	I456K	probably damaging	Het
Usp6nl	A	G	2: 6,400,323		probably benign	Het
Vit	T	A	17: 78,624,793	V443E	possibly damaging	Het
Whamm	G	A	7: 81,586,224	V392I	possibly damaging	Het
Zfhx4	A	G	3: 5,400,494	K1904R	probably damaging	Het
Zfp352	A	T	4: 90,224,690	T356S	probably damaging	Het

Other mutations in Nectin3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01456:Nectin3	APN	16	46458853	missense	probably benign	0.23
R0373:Nectin3	UTSW	16	46458187	missense	probably damaging	0.99
R1219:Nectin3	UTSW	16	46454679	nonsense	probably null
R1251:Nectin3	UTSW	16	46463842	missense	possibly damaging	0.82
R1398:Nectin3	UTSW	16	46448756	missense	possibly damaging	0.95
R1439:Nectin3	UTSW	16	46448394	nonsense	probably null
R2250:Nectin3	UTSW	16	46454736	missense	probably benign	0.00
R2448:Nectin3	UTSW	16	46448515	splice site	probably null
R2483:Nectin3	UTSW	16	46395179	missense	possibly damaging	0.83
R4523:Nectin3	UTSW	16	46448590	missense	probably benign	0.15
R4709:Nectin3	UTSW	16	46463943	missense	possibly damaging	0.58
R4809:Nectin3	UTSW	16	46448160	intron	probably benign
R4884:Nectin3	UTSW	16	46448886	missense	probably benign	0.01
R5051:Nectin3	UTSW	16	46448550	missense	possibly damaging	0.95
R5061:Nectin3	UTSW	16	46448449	missense	probably benign	0.03
R5272:Nectin3	UTSW	16	46448476	missense	possibly damaging	0.82
R5365:Nectin3	UTSW	16	46464106	nonsense	probably null
R5768:Nectin3	UTSW	16	46458817	missense	probably damaging	0.98
R5987:Nectin3	UTSW	16	46464145	missense	probably benign	0.00
R6029:Nectin3	UTSW	16	46436400	missense	probably benign	0.08
R6131:Nectin3	UTSW	16	46395152	missense	probably damaging	0.98
R6251:Nectin3	UTSW	16	46395150	missense	probably damaging	0.99
R6299:Nectin3	UTSW	16	46463982	missense	probably damaging	0.98
R6347:Nectin3	UTSW	16	46458124	missense	probably benign	0.01
R6360:Nectin3	UTSW	16	46411109	missense	probably benign	0.09
R6505:Nectin3	UTSW	16	46448821	missense	possibly damaging	0.68
R6703:Nectin3	UTSW	16	46463842	missense	probably damaging	0.99
R6869:Nectin3	UTSW	16	46395143	missense	probably damaging	0.96
R7184:Nectin3	UTSW	16	46395121	missense	possibly damaging	0.66
R7298:Nectin3	UTSW	16	46448396	missense	probably damaging	1.00
R7455:Nectin3	UTSW	16	46496742	nonsense	probably null
R7973:Nectin3	UTSW	16	46396121	missense	probably benign	0.13
R7993:Nectin3	UTSW	16	46458821	missense	probably benign	0.01
R8108:Nectin3	UTSW	16	46464121	missense	possibly damaging	0.84
R8259:Nectin3	UTSW	16	46436391	missense	probably benign	0.00
R8511:Nectin3	UTSW	16	46464000	missense	probably damaging	1.00
R8971:Nectin3	UTSW	16	46448902	missense	probably benign
R9195:Nectin3	UTSW	16	46458896	nonsense	probably null
R9264:Nectin3	UTSW	16	46454635	missense	probably damaging	1.00
R9492:Nectin3	UTSW	16	46395148	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTCAGCATAATCACTCGGGAAGGC -3'
(R):5'- CAGTCGCACAGATTGACTGGGAAG -3'

Sequencing Primer
(F):5'- TCACTCGGGAAGGCAATATTC -3'
(R):5'- AGGTGATCTTGGTGAAATGGAATC -3'

Posted On

2013-06-11