Incidental Mutation 'R5717:Dirc2'
ID451239
Institutional Source Beutler Lab
Gene Symbol Dirc2
Ensembl Gene ENSMUSG00000022848
Gene Namedisrupted in renal carcinoma 2 (human)
SynonymsRCC4
MMRRC Submission 043337-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.829) question?
Stock #R5717 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location35694062-35769356 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35719429 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 341 (F341L)
Ref Sequence ENSEMBL: ENSMUSP00000023554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023554] [ENSMUST00000149892]
Predicted Effect probably benign
Transcript: ENSMUST00000023554
AA Change: F341L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000023554
Gene: ENSMUSG00000022848
AA Change: F341L

DomainStartEndE-ValueType
low complexity region 8 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
transmembrane domain 90 111 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
transmembrane domain 231 250 N/A INTRINSIC
low complexity region 251 258 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 344 366 N/A INTRINSIC
transmembrane domain 381 403 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
transmembrane domain 441 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149892
SMART Domains Protein: ENSMUSP00000120775
Gene: ENSMUSG00000022848

DomainStartEndE-ValueType
low complexity region 8 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
transmembrane domain 90 111 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157168
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound protein from the major facilitator superfamily of transporters. Disruption of this gene by translocation has been associated with haplo-insufficiency and renal cell carcinomas. Alternatively spliced transcript variants have been described, but their biological validity has not yet been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik A T 19: 42,053,045 H205L probably benign Het
Acss2 T C 2: 155,561,153 L617S probably damaging Het
Adgrl4 T C 3: 151,492,334 V77A probably benign Het
Adnp2 A G 18: 80,128,264 S977P probably benign Het
Ankrd11 T C 8: 122,892,638 K1492E possibly damaging Het
B4galt5 G A 2: 167,306,629 R190C probably damaging Het
Bbs1 A G 19: 4,897,326 V355A possibly damaging Het
Cenpj GTTTT GTTTTT 14: 56,553,521 probably null Het
Ckap2 T C 8: 22,175,047 E467G probably damaging Het
Cry1 A T 10: 85,146,416 H355Q probably damaging Het
Cspg4 G T 9: 56,885,798 M272I probably benign Het
Dicer1 T A 12: 104,705,128 Y961F probably damaging Het
Epha2 A T 4: 141,322,071 M689L probably benign Het
Foxc1 C T 13: 31,807,488 A94V probably benign Het
Fras1 T C 5: 96,781,737 V4000A possibly damaging Het
Frmd8 G T 19: 5,873,368 probably benign Het
Gm5218 A G 15: 81,499,277 noncoding transcript Het
Gm7735 T C 16: 89,169,542 L18P unknown Het
Hr C T 14: 70,566,176 T808I probably benign Het
Hyal6 T C 6: 24,743,691 M462T probably benign Het
Igkv6-20 T A 6: 70,336,428 probably benign Het
Igkv8-27 T A 6: 70,171,934 T59S probably benign Het
Itga11 A G 9: 62,752,249 T428A probably benign Het
Klk1b16 A G 7: 44,139,489 I49V probably benign Het
Matn2 G T 15: 34,399,091 E375* probably null Het
Msgn1 T C 12: 11,208,518 Y144C probably damaging Het
Myh1 A G 11: 67,208,956 N564S probably benign Het
Mypn A G 10: 63,127,776 V972A probably damaging Het
Olfr1209 T C 2: 88,910,022 I124V possibly damaging Het
Olfr235 A G 19: 12,269,156 K309E probably benign Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Ppp2r5d A G 17: 46,687,894 S81P probably damaging Het
Ptgis C T 2: 167,208,364 probably benign Het
Ptprr A G 10: 116,048,113 N25S probably benign Het
Rnf123 G A 9: 108,067,424 T456I probably damaging Het
Rpl6l T C 10: 111,126,023 noncoding transcript Het
Rps25 A G 9: 44,408,750 Y23C probably benign Het
Sec24a A G 11: 51,707,210 V879A probably benign Het
Sema6a G A 18: 47,249,263 A739V probably benign Het
Senp6 A T 9: 80,092,312 I4F probably damaging Het
Stoml3 A T 3: 53,505,516 Q197L probably damaging Het
Ttn T A 2: 76,747,747 K24267N probably damaging Het
Vmn1r43 T C 6: 89,869,923 S194G probably damaging Het
Vmn2r17 C T 5: 109,427,274 T149I possibly damaging Het
Wdr72 T A 9: 74,148,205 Y239N probably damaging Het
Zfp423 A T 8: 87,686,559 probably null Het
Zfp759 T A 13: 67,138,708 C114S probably damaging Het
Other mutations in Dirc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02505:Dirc2 APN 16 35735558 missense probably benign 0.01
IGL02990:Dirc2 APN 16 35735491 missense possibly damaging 0.68
R0166:Dirc2 UTSW 16 35719314 missense possibly damaging 0.49
R0319:Dirc2 UTSW 16 35750514 missense probably benign 0.01
R0323:Dirc2 UTSW 16 35719360 frame shift probably null
R0497:Dirc2 UTSW 16 35735604 missense probably benign 0.40
R1240:Dirc2 UTSW 16 35698009 missense probably benign 0.00
R1460:Dirc2 UTSW 16 35719366 missense probably benign 0.25
R2115:Dirc2 UTSW 16 35697939 missense probably benign 0.17
R4502:Dirc2 UTSW 16 35719417 missense probably benign 0.00
R4503:Dirc2 UTSW 16 35719417 missense probably benign 0.00
R4563:Dirc2 UTSW 16 35697942 missense probably damaging 1.00
R4834:Dirc2 UTSW 16 35735575 missense probably benign 0.08
R5278:Dirc2 UTSW 16 35697988 missense probably damaging 1.00
R5651:Dirc2 UTSW 16 35735616 missense probably benign 0.25
R5947:Dirc2 UTSW 16 35730306 missense probably benign 0.14
R6176:Dirc2 UTSW 16 35704797 missense probably benign
R7155:Dirc2 UTSW 16 35735577 missense probably benign 0.02
R7450:Dirc2 UTSW 16 35768974 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- ACGTACTTTCCTGTGAACTGAAAGC -3'
(R):5'- TCTGTGAGCTGTAGACTCCAAAC -3'

Sequencing Primer
(F):5'- CTGTGAACTGAAAGCCTTTACC -3'
(R):5'- TAGACTCCAAACAGTTTATAAGAGGG -3'
Posted On2017-01-03