Mutagenetix > Incidental Mutation

Incidental Mutation 'R0550:Tnfrsf21'

45126

Institutional Source

Beutler Lab

Gene Symbol

Tnfrsf21

Ensembl Gene

ENSMUSG00000023915

Gene Name

tumor necrosis factor receptor superfamily, member 21

Synonyms

DR6, TR7, Death receptor 6

MMRRC Submission

038742-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.200) question?

Stock #

R0550 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43016555-43089188 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 43038213 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 239 (H239Y)

Ref Sequence

ENSEMBL: ENSMUSP00000024708 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024708]

AlphaFold

Q9EPU5

Predicted Effect

probably benign
Transcript: ENSMUST00000024708
AA Change: H239Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000024708
Gene: ENSMUSG00000023915
AA Change: H239Y

Domain	Start	End	E-Value	Type
TNFR	50	88	1.58e1	SMART
TNFR	91	131	3.42e-3	SMART
TNFR	133	168	9.31e-5	SMART
TNFR	171	211	1.1e-1	SMART
transmembrane domain	351	370	N/A	INTRINSIC
DEATH	393	498	1.41e-22	SMART
low complexity region	511	526	N/A	INTRINSIC
low complexity region	562	575	N/A	INTRINSIC
PDB:2DBH\|A	576	655	5e-48	PDB

Meta Mutation Damage Score

0.0680

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 97.0%
20x: 94.2%

Validation Efficiency

99% (76/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The encoded protein activates nuclear factor kappa-B and mitogen-activated protein kinase 8 (also called c-Jun N-terminal kinase 1), and induces cell apoptosis. Through its death domain, the encoded receptor interacts with tumor necrosis factor receptor type 1-associated death domain (TRADD) protein, which is known to mediate signal transduction of tumor necrosis factor receptors. Knockout studies in mice suggest that this gene plays a role in T-helper cell activation, and may be involved in inflammation and immune regulation. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired T cell differentiation and an enhanced Th2 response. Mice homozygous for a different knock-out allele show increased CD4+ T cell proliferation and Th2 cytokine production, and enhanced B cell proliferation, survival, and humoral responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	T	11: 110,293,840	Y947N	probably damaging	Het
Acss3	C	A	10: 107,053,471	G163C	probably damaging	Het
Adcy10	A	G	1: 165,565,315	T1367A	probably benign	Het
Adcy2	A	T	13: 68,982,361	S136T	probably benign	Het
Ahdc1	G	A	4: 133,063,037	V530I	probably benign	Het
Aldh16a1	C	T	7: 45,146,229		probably null	Het
Ankrd36	T	C	11: 5,607,429		probably null	Het
Aqr	A	C	2: 114,132,976	N664K	probably damaging	Het
Atp6v1c1	T	C	15: 38,682,929		probably benign	Het
Atp8b2	C	T	3: 89,959,061		probably benign	Het
Bbx	T	C	16: 50,274,533		probably benign	Het
Bmper	T	A	9: 23,373,885	D243E	probably benign	Het
Casz1	GCCACCACCACCACCACCACCAC	GCCACCACCACCACCACCAC	4: 148,952,284		probably benign	Het
Catsperd	T	C	17: 56,663,427		probably null	Het
Ccdc92b	T	A	11: 74,629,945		probably null	Het
Cd2bp2	G	T	7: 127,193,824	T342K	probably damaging	Het
Clrn3	T	A	7: 135,528,425	I27F	possibly damaging	Het
Cnih3	TTGACGAG	T	1: 181,406,477		probably null	Het
Cntnap3	T	C	13: 64,762,000	T764A	possibly damaging	Het
Cttnbp2	T	G	6: 18,435,309	K183N	possibly damaging	Het
Cwc27	G	A	13: 104,804,949	P155L	probably damaging	Het
Dcaf10	T	C	4: 45,372,753	S389P	probably benign	Het
Ddx18	T	C	1: 121,555,375	K561E	probably benign	Het
Dkk3	A	G	7: 112,158,245	F51L	probably damaging	Het
Dnaic1	C	T	4: 41,596,274	R20*	probably null	Het
Dr1	G	A	5: 108,269,605	G6S	probably benign	Het
Dync2h1	A	T	9: 7,120,954		probably null	Het
Eif3l	A	G	15: 79,076,867	Y16C	probably damaging	Het
Epb41	A	G	4: 131,975,613	I464T	probably damaging	Het
Erc2	A	G	14: 28,271,651	K546E	possibly damaging	Het
F830045P16Rik	T	C	2: 129,463,509	D315G	probably damaging	Het
Fads6	A	G	11: 115,296,677	I64T	probably benign	Het
Fshr	T	C	17: 89,045,125	N107S	probably benign	Het
Gbp11	A	T	5: 105,343,750	N60K	probably benign	Het
Gm2a	C	T	11: 55,103,665	Q54*	probably null	Het
Hydin	A	G	8: 110,587,775	D4297G	probably benign	Het
Il6st	G	A	13: 112,475,114		probably null	Het
Inpp4b	T	A	8: 81,997,337	H499Q	probably benign	Het
Kif5c	A	G	2: 49,758,912	K956R	possibly damaging	Het
Krt74	G	A	15: 101,760,679		noncoding transcript	Het
Map3k9	A	T	12: 81,725,781	L649Q	probably damaging	Het
Mdn1	A	G	4: 32,730,479	D2871G	probably benign	Het
Mylk4	T	C	13: 32,716,666	T294A	probably benign	Het
Nbeal2	C	T	9: 110,642,158	V252I	probably benign	Het
Nectin3	A	G	16: 46,458,820	I265T	possibly damaging	Het
Olfr1065	A	T	2: 86,445,876	Y35*	probably null	Het
Olfr1109	G	T	2: 87,093,129	H89Q	probably benign	Het
Olfr1259	A	G	2: 89,943,389	I242T	probably damaging	Het
Olfr1447	A	T	19: 12,901,800		probably null	Het
Olfr181	A	G	16: 58,926,385	F62S	probably damaging	Het
Olfr554	G	A	7: 102,640,950	E235K	possibly damaging	Het
Olfr910	T	A	9: 38,539,380	C162S	probably damaging	Het
Opn1sw	A	T	6: 29,380,204	L71Q	probably damaging	Het
Pced1a	G	A	2: 130,419,633	P367S	probably benign	Het
Pkhd1	A	T	1: 20,347,223	M2568K	probably null	Het
Pla2r1	A	G	2: 60,425,350		probably null	Het
Plpp1	T	C	13: 112,834,985	I62T	probably benign	Het
Polr3g	G	A	13: 81,694,773	T41I	probably damaging	Het
Ptch2	T	C	4: 117,096,433		probably benign	Het
Sema4g	A	T	19: 44,997,665	H315L	probably benign	Het
Setd1b	G	T	5: 123,157,660	S1097I	unknown	Het
Sfxn4	A	G	19: 60,850,945		probably benign	Het
Sh3tc1	T	C	5: 35,699,784	E1237G	probably damaging	Het
Slc25a38	A	T	9: 120,123,643	N287I	probably benign	Het
Slc25a48	A	G	13: 56,448,998	T31A	probably benign	Het
Slc6a12	G	A	6: 121,356,918	V238I	probably damaging	Het
Slc8b1	A	G	5: 120,531,155		probably benign	Het
Slco4c1	A	C	1: 96,867,859	V158G	probably damaging	Het
Sptbn4	T	C	7: 27,364,378	T2208A	probably benign	Het
Srebf1	G	A	11: 60,201,676	T843I	probably benign	Het
Srl	A	G	16: 4,487,565	W101R	probably damaging	Het
St6galnac4	T	A	2: 32,594,019	C76*	probably null	Het
Tdrd3	C	A	14: 87,486,220	T290K	probably damaging	Het
Trpm3	A	G	19: 22,987,812	E1547G	probably damaging	Het
Ubn1	A	G	16: 5,062,620		probably null	Het
Usp10	T	A	8: 119,947,801	I456K	probably damaging	Het
Usp6nl	A	G	2: 6,400,323		probably benign	Het
Vit	T	A	17: 78,624,793	V443E	possibly damaging	Het
Whamm	G	A	7: 81,586,224	V392I	possibly damaging	Het
Zfhx4	A	G	3: 5,400,494	K1904R	probably damaging	Het
Zfp352	A	T	4: 90,224,690	T356S	probably damaging	Het

Other mutations in Tnfrsf21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01406:Tnfrsf21	APN	17	43037946	missense	probably damaging	1.00
IGL01663:Tnfrsf21	APN	17	43087811	missense	probably benign	0.13
IGL01811:Tnfrsf21	APN	17	43037613	missense	probably benign
IGL01916:Tnfrsf21	APN	17	43039803	missense	probably benign	0.00
IGL01934:Tnfrsf21	APN	17	43065187	missense	probably benign	0.15
IGL02184:Tnfrsf21	APN	17	43085463	missense	probably benign	0.37
IGL02292:Tnfrsf21	APN	17	43039911	missense	probably benign
IGL02385:Tnfrsf21	APN	17	43040051	missense	probably damaging	1.00
IGL02710:Tnfrsf21	APN	17	43087929	missense	probably damaging	0.97
IGL03001:Tnfrsf21	APN	17	43087895	missense	probably damaging	0.99
IGL03003:Tnfrsf21	APN	17	43039943	missense	probably damaging	1.00
PIT4480001:Tnfrsf21	UTSW	17	43037911	missense	probably benign	0.00
R0007:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0046:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0088:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0091:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0102:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0102:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0103:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0105:Tnfrsf21	UTSW	17	43040191	critical splice donor site	probably null
R0105:Tnfrsf21	UTSW	17	43040191	critical splice donor site	probably null
R0206:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0211:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0240:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0243:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0308:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0363:Tnfrsf21	UTSW	17	43037877	missense	probably benign	0.01
R0456:Tnfrsf21	UTSW	17	43038091	missense	probably benign	0.01
R0522:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0523:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0525:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0528:Tnfrsf21	UTSW	17	43037614	missense	probably benign
R0543:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0549:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0699:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0724:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0734:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0847:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0880:Tnfrsf21	UTSW	17	43037842	nonsense	probably null
R1591:Tnfrsf21	UTSW	17	43085374	missense	probably benign	0.01
R2069:Tnfrsf21	UTSW	17	43037938	missense	possibly damaging	0.67
R2153:Tnfrsf21	UTSW	17	43087872	missense	probably damaging	1.00
R2323:Tnfrsf21	UTSW	17	43085529	nonsense	probably null
R3941:Tnfrsf21	UTSW	17	43038010	missense	probably damaging	1.00
R4438:Tnfrsf21	UTSW	17	43087842	missense	possibly damaging	0.49
R4509:Tnfrsf21	UTSW	17	43085388	missense	probably benign	0.00
R4510:Tnfrsf21	UTSW	17	43065019	missense	probably damaging	0.98
R4511:Tnfrsf21	UTSW	17	43065019	missense	probably damaging	0.98
R4708:Tnfrsf21	UTSW	17	43038232	missense	possibly damaging	0.66
R4721:Tnfrsf21	UTSW	17	43085504	missense	probably damaging	1.00
R4811:Tnfrsf21	UTSW	17	43037730	missense	probably benign	0.00
R5437:Tnfrsf21	UTSW	17	43037862	missense	possibly damaging	0.55
R5767:Tnfrsf21	UTSW	17	43037659	missense	probably damaging	0.98
R6057:Tnfrsf21	UTSW	17	43039715	missense	possibly damaging	0.86
R6392:Tnfrsf21	UTSW	17	43017088	missense	probably benign	0.00
R6860:Tnfrsf21	UTSW	17	43017066	missense	probably benign
R7253:Tnfrsf21	UTSW	17	43037667	missense	probably benign	0.00
R7288:Tnfrsf21	UTSW	17	43037818	missense	possibly damaging	0.86
R7643:Tnfrsf21	UTSW	17	43037916	missense	probably benign	0.00
R7937:Tnfrsf21	UTSW	17	43037925	missense	probably benign	0.01
R8098:Tnfrsf21	UTSW	17	43039899	missense	probably benign
R8495:Tnfrsf21	UTSW	17	43038237	missense	probably benign
R8865:Tnfrsf21	UTSW	17	43085481	missense	probably damaging	1.00
R8991:Tnfrsf21	UTSW	17	43085408	missense	probably benign	0.03
R9088:Tnfrsf21	UTSW	17	43037716	missense	probably damaging	1.00
R9150:Tnfrsf21	UTSW	17	43087800	missense	probably damaging	1.00
R9220:Tnfrsf21	UTSW	17	43087910	missense	probably damaging	1.00
V3553:Tnfrsf21	UTSW	17	43037931	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTAAAGCTCACACGGACTGTCTGG -3'
(R):5'- GCTCCATCTACACACGATTAGCTCC -3'

Sequencing Primer
(F):5'- GGACTGTCTGGGTCAGAAC -3'
(R):5'- acaactaaaatcactcaactcactc -3'

Posted On

2013-06-11