Mutagenetix > Incidental Mutation

Incidental Mutation 'R0550:Vit'

45128

Institutional Source

Beutler Lab

Gene Symbol

Vit

Ensembl Gene

ENSMUSG00000024076

Gene Name

vitrin

Synonyms

MMRRC Submission

038742-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R0550 (G1)

Quality Score

193

Status

Validated

Chromosome

Chromosomal Location

78508063-78627409 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 78624793 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 443 (V443E)

Ref Sequence

ENSEMBL: ENSMUSP00000024880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024880]

AlphaFold

Q8VHI5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000024880
AA Change: V443E

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000024880
Gene: ENSMUSG00000024076
AA Change: V443E

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
LCCL	42	124	2.5e-45	SMART
low complexity region	148	171	N/A	INTRINSIC
VWA	263	451	7.34e-39	SMART
VWA	465	641	1.02e-46	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 97.0%
20x: 94.2%

Validation Efficiency

99% (76/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix (ECM) protein. The protein may be associated with cell adhesion and migration. High levels of expression of the protein in specific parts of the brain suggest its likely role in neural development. [provided by RefSeq, Jun 2016]
PHENOTYPE: Embryos homozygous for a knock-out allele show decreased spinal cord size associated with reduced cell proliferation and altered cell differentiation in the central canal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	T	11: 110,293,840	Y947N	probably damaging	Het
Acss3	C	A	10: 107,053,471	G163C	probably damaging	Het
Adcy10	A	G	1: 165,565,315	T1367A	probably benign	Het
Adcy2	A	T	13: 68,982,361	S136T	probably benign	Het
Ahdc1	G	A	4: 133,063,037	V530I	probably benign	Het
Aldh16a1	C	T	7: 45,146,229		probably null	Het
Ankrd36	T	C	11: 5,607,429		probably null	Het
Aqr	A	C	2: 114,132,976	N664K	probably damaging	Het
Atp6v1c1	T	C	15: 38,682,929		probably benign	Het
Atp8b2	C	T	3: 89,959,061		probably benign	Het
Bbx	T	C	16: 50,274,533		probably benign	Het
Bmper	T	A	9: 23,373,885	D243E	probably benign	Het
Casz1	GCCACCACCACCACCACCACCAC	GCCACCACCACCACCACCAC	4: 148,952,284		probably benign	Het
Catsperd	T	C	17: 56,663,427		probably null	Het
Ccdc92b	T	A	11: 74,629,945		probably null	Het
Cd2bp2	G	T	7: 127,193,824	T342K	probably damaging	Het
Clrn3	T	A	7: 135,528,425	I27F	possibly damaging	Het
Cnih3	TTGACGAG	T	1: 181,406,477		probably null	Het
Cntnap3	T	C	13: 64,762,000	T764A	possibly damaging	Het
Cttnbp2	T	G	6: 18,435,309	K183N	possibly damaging	Het
Cwc27	G	A	13: 104,804,949	P155L	probably damaging	Het
Dcaf10	T	C	4: 45,372,753	S389P	probably benign	Het
Ddx18	T	C	1: 121,555,375	K561E	probably benign	Het
Dkk3	A	G	7: 112,158,245	F51L	probably damaging	Het
Dnaic1	C	T	4: 41,596,274	R20*	probably null	Het
Dr1	G	A	5: 108,269,605	G6S	probably benign	Het
Dync2h1	A	T	9: 7,120,954		probably null	Het
Eif3l	A	G	15: 79,076,867	Y16C	probably damaging	Het
Epb41	A	G	4: 131,975,613	I464T	probably damaging	Het
Erc2	A	G	14: 28,271,651	K546E	possibly damaging	Het
F830045P16Rik	T	C	2: 129,463,509	D315G	probably damaging	Het
Fads6	A	G	11: 115,296,677	I64T	probably benign	Het
Fshr	T	C	17: 89,045,125	N107S	probably benign	Het
Gbp11	A	T	5: 105,343,750	N60K	probably benign	Het
Gm2a	C	T	11: 55,103,665	Q54*	probably null	Het
Hydin	A	G	8: 110,587,775	D4297G	probably benign	Het
Il6st	G	A	13: 112,475,114		probably null	Het
Inpp4b	T	A	8: 81,997,337	H499Q	probably benign	Het
Kif5c	A	G	2: 49,758,912	K956R	possibly damaging	Het
Krt74	G	A	15: 101,760,679		noncoding transcript	Het
Map3k9	A	T	12: 81,725,781	L649Q	probably damaging	Het
Mdn1	A	G	4: 32,730,479	D2871G	probably benign	Het
Mylk4	T	C	13: 32,716,666	T294A	probably benign	Het
Nbeal2	C	T	9: 110,642,158	V252I	probably benign	Het
Nectin3	A	G	16: 46,458,820	I265T	possibly damaging	Het
Olfr1065	A	T	2: 86,445,876	Y35*	probably null	Het
Olfr1109	G	T	2: 87,093,129	H89Q	probably benign	Het
Olfr1259	A	G	2: 89,943,389	I242T	probably damaging	Het
Olfr1447	A	T	19: 12,901,800		probably null	Het
Olfr181	A	G	16: 58,926,385	F62S	probably damaging	Het
Olfr554	G	A	7: 102,640,950	E235K	possibly damaging	Het
Olfr910	T	A	9: 38,539,380	C162S	probably damaging	Het
Opn1sw	A	T	6: 29,380,204	L71Q	probably damaging	Het
Pced1a	G	A	2: 130,419,633	P367S	probably benign	Het
Pkhd1	A	T	1: 20,347,223	M2568K	probably null	Het
Pla2r1	A	G	2: 60,425,350		probably null	Het
Plpp1	T	C	13: 112,834,985	I62T	probably benign	Het
Polr3g	G	A	13: 81,694,773	T41I	probably damaging	Het
Ptch2	T	C	4: 117,096,433		probably benign	Het
Sema4g	A	T	19: 44,997,665	H315L	probably benign	Het
Setd1b	G	T	5: 123,157,660	S1097I	unknown	Het
Sfxn4	A	G	19: 60,850,945		probably benign	Het
Sh3tc1	T	C	5: 35,699,784	E1237G	probably damaging	Het
Slc25a38	A	T	9: 120,123,643	N287I	probably benign	Het
Slc25a48	A	G	13: 56,448,998	T31A	probably benign	Het
Slc6a12	G	A	6: 121,356,918	V238I	probably damaging	Het
Slc8b1	A	G	5: 120,531,155		probably benign	Het
Slco4c1	A	C	1: 96,867,859	V158G	probably damaging	Het
Sptbn4	T	C	7: 27,364,378	T2208A	probably benign	Het
Srebf1	G	A	11: 60,201,676	T843I	probably benign	Het
Srl	A	G	16: 4,487,565	W101R	probably damaging	Het
St6galnac4	T	A	2: 32,594,019	C76*	probably null	Het
Tdrd3	C	A	14: 87,486,220	T290K	probably damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Trpm3	A	G	19: 22,987,812	E1547G	probably damaging	Het
Ubn1	A	G	16: 5,062,620		probably null	Het
Usp10	T	A	8: 119,947,801	I456K	probably damaging	Het
Usp6nl	A	G	2: 6,400,323		probably benign	Het
Whamm	G	A	7: 81,586,224	V392I	possibly damaging	Het
Zfhx4	A	G	3: 5,400,494	K1904R	probably damaging	Het
Zfp352	A	T	4: 90,224,690	T356S	probably damaging	Het

Other mutations in Vit

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Vit	APN	17	78601907	critical splice donor site	probably null
IGL00929:Vit	APN	17	78579401	missense	probably damaging	0.98
IGL01447:Vit	APN	17	78625204	missense	probably damaging	1.00
IGL02000:Vit	APN	17	78605486	missense	possibly damaging	0.94
IGL02230:Vit	APN	17	78619627	missense	probably damaging	1.00
IGL02245:Vit	APN	17	78625051	missense	probably damaging	1.00
IGL02315:Vit	APN	17	78622658	missense	possibly damaging	0.80
IGL03133:Vit	APN	17	78566071	missense	probably benign
R0025:Vit	UTSW	17	78599835	missense	probably benign	0.00
R0025:Vit	UTSW	17	78599835	missense	probably benign	0.00
R0520:Vit	UTSW	17	78625159	missense	probably damaging	1.00
R0565:Vit	UTSW	17	78624837	missense	probably damaging	1.00
R0856:Vit	UTSW	17	78619657	missense	possibly damaging	0.53
R1155:Vit	UTSW	17	78566027	missense	probably damaging	1.00
R1327:Vit	UTSW	17	78625200	missense	probably damaging	1.00
R1690:Vit	UTSW	17	78624865	missense	probably damaging	1.00
R1802:Vit	UTSW	17	78605511	missense	possibly damaging	0.91
R1822:Vit	UTSW	17	78622836	missense	probably benign	0.01
R1826:Vit	UTSW	17	78534676	missense	probably benign	0.22
R1827:Vit	UTSW	17	78546446	critical splice donor site	probably null
R1862:Vit	UTSW	17	78622746	missense	probably damaging	1.00
R2235:Vit	UTSW	17	78605438	missense	probably benign	0.01
R2571:Vit	UTSW	17	78586745	missense	probably benign
R4011:Vit	UTSW	17	78534692	splice site	probably benign
R4190:Vit	UTSW	17	78586826	missense	probably benign	0.13
R4191:Vit	UTSW	17	78586826	missense	probably benign	0.13
R4192:Vit	UTSW	17	78586826	missense	probably benign	0.13
R4193:Vit	UTSW	17	78586826	missense	probably benign	0.13
R4635:Vit	UTSW	17	78574212	missense	probably benign	0.01
R4705:Vit	UTSW	17	78625114	missense	probably damaging	1.00
R4841:Vit	UTSW	17	78601879	missense	probably benign
R4842:Vit	UTSW	17	78601879	missense	probably benign
R4884:Vit	UTSW	17	78624753	missense	probably damaging	0.99
R4923:Vit	UTSW	17	78586841	missense	probably benign	0.03
R5128:Vit	UTSW	17	78625146	missense	probably damaging	1.00
R5272:Vit	UTSW	17	78586835	missense	probably benign
R5779:Vit	UTSW	17	78546426	missense	probably benign
R6596:Vit	UTSW	17	78622845	missense	probably benign	0.35
R6658:Vit	UTSW	17	78622803	missense	possibly damaging	0.93
R6792:Vit	UTSW	17	78579399	missense	probably damaging	1.00
R6894:Vit	UTSW	17	78626758	nonsense	probably null
R7032:Vit	UTSW	17	78624865	missense	probably damaging	1.00
R7061:Vit	UTSW	17	78625156	missense	probably damaging	1.00
R7102:Vit	UTSW	17	78624997	missense	probably damaging	1.00
R7106:Vit	UTSW	17	78586799	missense	probably benign
R7292:Vit	UTSW	17	78605498	missense	probably benign	0.03
R7413:Vit	UTSW	17	78624880	missense	probably damaging	1.00
R8191:Vit	UTSW	17	78546399	missense	probably benign	0.00
R8385:Vit	UTSW	17	78619637	missense	probably benign	0.01
R9106:Vit	UTSW	17	78626849	missense	probably damaging	1.00
R9314:Vit	UTSW	17	78619615	missense	probably benign	0.02
R9433:Vit	UTSW	17	78624984	missense	probably damaging	1.00
R9588:Vit	UTSW	17	78622650	missense	probably damaging	0.98
R9772:Vit	UTSW	17	78624969	missense	probably damaging	1.00
X0023:Vit	UTSW	17	78566164	missense	probably benign
X0064:Vit	UTSW	17	78624885	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCATTTTCCACTGAGACAGGGACC -3'
(R):5'- TGTCGAACCCAAATTCGAGCCG -3'

Sequencing Primer
(F):5'- CTACTCTGAAGTCTACTACAGGAAGG -3'
(R):5'- GTCGGTGTCTGAAATCTCAAACTC -3'

Posted On

2013-06-11