Incidental Mutation 'R5718:Slc5a5'
ID 451282
Institutional Source Beutler Lab
Gene Symbol Slc5a5
Ensembl Gene ENSMUSG00000000792
Gene Name solute carrier family 5 (sodium iodide symporter), member 5
Synonyms NIS
MMRRC Submission 043338-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5718 (G1)
Quality Score 210
Status Not validated
Chromosome 8
Chromosomal Location 70882889-70892757 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 70887755 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 484 (T484S)
Ref Sequence ENSEMBL: ENSMUSP00000000809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000809]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000000809
AA Change: T484S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000000809
Gene: ENSMUSG00000000792
AA Change: T484S

DomainStartEndE-ValueType
Pfam:SSF 47 452 2.5e-43 PFAM
transmembrane domain 522 544 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium glucose cotransporter family. The encoded protein is responsible for the uptake of iodine in tissues such as the thyroid and lactating breast tissue. The iodine taken up by the thyroid is incorporated into the metabolic regulators triiodothyronine (T3) and tetraiodothyronine (T4). Mutations in this gene are associated with thyroid dyshormonogenesis 1.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced T3 and T4 levels when fed a minimal iodine diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 T C 8: 27,113,486 probably null Het
Ahctf1 G T 1: 179,769,339 H81N possibly damaging Het
Alyref2 T C 1: 171,504,110 S152P possibly damaging Het
Arhgef7 C T 8: 11,785,774 T20I probably damaging Het
Armc3 T G 2: 19,303,799 Y759* probably null Het
Atg5 A G 10: 44,362,987 S255G probably benign Het
Atp11b A G 3: 35,837,516 I1026V probably benign Het
Atp1a2 C A 1: 172,279,442 K770N probably damaging Het
Bptf G T 11: 107,111,434 A284E probably damaging Het
Celsr2 A G 3: 108,393,358 S815P probably benign Het
Chrna5 A G 9: 54,998,105 H67R probably benign Het
Cic A G 7: 25,272,778 I645V probably benign Het
Clpx A T 9: 65,299,964 Q48L probably benign Het
Crhr2 G A 6: 55,092,100 Q397* probably null Het
Cyp11a1 G A 9: 58,018,225 V48I probably benign Het
Dchs1 C T 7: 105,755,748 R2529H probably benign Het
Dnah7c A T 1: 46,748,666 H3293L possibly damaging Het
Dock6 G T 9: 21,824,493 D986E probably benign Het
Efcab6 T A 15: 83,904,238 N952Y probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epg5 G A 18: 77,986,403 C1327Y probably damaging Het
Fbxw18 T C 9: 109,691,568 E241G probably benign Het
Fsd1 T G 17: 55,990,542 probably benign Het
Gcnt3 A G 9: 70,034,270 S339P probably benign Het
Gldc T A 19: 30,110,772 K829* probably null Het
Gli3 G A 13: 15,478,165 probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Hmcn1 A T 1: 150,609,666 I4395N probably damaging Het
Hmcn1 A T 1: 150,690,600 C2217* probably null Het
Hmgxb3 A G 18: 61,140,837 M861T probably benign Het
Ift172 A G 5: 31,255,277 S1545P possibly damaging Het
Jak3 C A 8: 71,684,354 L725M probably damaging Het
Lrig2 A T 3: 104,468,615 C90* probably null Het
Mcm7 C T 5: 138,164,819 R357H possibly damaging Het
Mcoln2 T C 3: 146,181,826 S333P probably damaging Het
Mrpl22 A T 11: 58,177,283 I136L probably benign Het
Ncam2 A T 16: 81,589,814 probably null Het
Ncdn G A 4: 126,749,950 Q360* probably null Het
Nsun2 A G 13: 69,623,284 K338E probably benign Het
Obscn T C 11: 59,036,808 T6105A probably damaging Het
Olfr171 G A 16: 19,624,389 S237F probably benign Het
Olfr957 A T 9: 39,511,042 L226H probably damaging Het
Pcnx4 T A 12: 72,567,194 F638I possibly damaging Het
Pfn3 T C 13: 55,415,040 I43V probably benign Het
Pigm C A 1: 172,377,445 probably null Het
Pkhd1l1 T A 15: 44,545,417 S2433R probably damaging Het
Pomt1 C A 2: 32,248,692 A440D possibly damaging Het
Ptprj T C 2: 90,458,269 D691G probably benign Het
Qrich1 T A 9: 108,528,823 S72T probably damaging Het
Ralgapa2 T A 2: 146,453,406 probably null Het
Rarg A C 15: 102,241,067 S156A probably damaging Het
Rasl11a A G 5: 146,847,144 K133R probably benign Het
Rcor1 A G 12: 111,101,635 D158G probably benign Het
Rpn2 C T 2: 157,321,827 T613M probably damaging Het
Sipa1l2 T A 8: 125,491,248 H450L probably damaging Het
Slc25a21 T C 12: 56,718,156 I263V probably benign Het
Slc25a32 A T 15: 39,097,562 V242E probably benign Het
Tdrd3 T C 14: 87,506,440 V608A probably benign Het
Thnsl1 C A 2: 21,212,000 H188Q possibly damaging Het
Tshz1 A T 18: 84,014,524 H586Q probably damaging Het
Vmn2r27 C T 6: 124,192,144 A676T possibly damaging Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Xbp1 T A 11: 5,521,903 F10I probably benign Het
Zbtb1 G A 12: 76,386,924 M561I probably benign Het
Zfp708 T C 13: 67,070,458 K446E probably benign Het
Other mutations in Slc5a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Slc5a5 APN 8 70888537 missense probably damaging 0.99
IGL01372:Slc5a5 APN 8 70890376 unclassified probably benign
IGL01394:Slc5a5 APN 8 70889388 nonsense probably null
IGL01571:Slc5a5 APN 8 70891332 unclassified probably benign
IGL02043:Slc5a5 APN 8 70892429 missense possibly damaging 0.84
IGL02186:Slc5a5 APN 8 70886120 missense possibly damaging 0.79
IGL02479:Slc5a5 APN 8 70888911 missense possibly damaging 0.67
IGL02559:Slc5a5 APN 8 70890271 missense probably damaging 1.00
IGL02892:Slc5a5 APN 8 70892517 missense probably damaging 1.00
IGL03388:Slc5a5 APN 8 70890328 missense probably benign 0.45
R0234:Slc5a5 UTSW 8 70889633 missense probably damaging 1.00
R0234:Slc5a5 UTSW 8 70889633 missense probably damaging 1.00
R0413:Slc5a5 UTSW 8 70891675 missense possibly damaging 0.63
R0662:Slc5a5 UTSW 8 70883875 missense probably benign 0.01
R0781:Slc5a5 UTSW 8 70890220 missense probably benign 0.19
R1061:Slc5a5 UTSW 8 70890221 missense probably benign 0.00
R1400:Slc5a5 UTSW 8 70889435 missense possibly damaging 0.87
R1524:Slc5a5 UTSW 8 70892334 missense probably damaging 1.00
R2033:Slc5a5 UTSW 8 70888587 missense probably damaging 0.99
R2072:Slc5a5 UTSW 8 70892439 missense possibly damaging 0.95
R2075:Slc5a5 UTSW 8 70892439 missense possibly damaging 0.95
R2110:Slc5a5 UTSW 8 70889751 splice site probably null
R2111:Slc5a5 UTSW 8 70889751 splice site probably null
R2112:Slc5a5 UTSW 8 70889751 splice site probably null
R2201:Slc5a5 UTSW 8 70892458 missense probably damaging 0.98
R3978:Slc5a5 UTSW 8 70889395 missense probably benign 0.00
R4244:Slc5a5 UTSW 8 70890286 missense probably benign
R5161:Slc5a5 UTSW 8 70888848 missense probably damaging 1.00
R5397:Slc5a5 UTSW 8 70891179 missense probably damaging 1.00
R5740:Slc5a5 UTSW 8 70888917 splice site probably null
R5869:Slc5a5 UTSW 8 70892330 missense probably damaging 1.00
R6268:Slc5a5 UTSW 8 70888620 missense probably damaging 1.00
R6290:Slc5a5 UTSW 8 70891178 missense probably damaging 1.00
R6292:Slc5a5 UTSW 8 70891178 missense probably damaging 1.00
R7098:Slc5a5 UTSW 8 70888538 missense probably damaging 0.99
R7354:Slc5a5 UTSW 8 70889603 missense probably damaging 1.00
R8777:Slc5a5 UTSW 8 70891290 missense possibly damaging 0.87
R8777-TAIL:Slc5a5 UTSW 8 70891290 missense possibly damaging 0.87
R8903:Slc5a5 UTSW 8 70892583 missense probably damaging 1.00
R9474:Slc5a5 UTSW 8 70884952 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAACTTGAACGTGGCGTG -3'
(R):5'- CCTGTGAGAGATGAGATCAATGTG -3'

Sequencing Primer
(F):5'- CGAGGGCCTTTGCACAAAC -3'
(R):5'- ATGAGATCAATGTGCCCCG -3'
Posted On 2017-01-03