Mutagenetix > Incidental Mutation

Incidental Mutation 'R5718:Slc5a5'

451282

Institutional Source

Beutler Lab

Gene Symbol

Slc5a5

Ensembl Gene

ENSMUSG00000000792

Gene Name

solute carrier family 5 (sodium iodide symporter), member 5

Synonyms

NIS

MMRRC Submission

043338-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5718 (G1)

Quality Score

210

Status

Not validated

Chromosome

Chromosomal Location

70882889-70892757 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 70887755 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 484 (T484S)

Ref Sequence

ENSEMBL: ENSMUSP00000000809 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000809]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000000809
AA Change: T484S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000000809
Gene: ENSMUSG00000000792
AA Change: T484S

Domain	Start	End	E-Value	Type
Pfam:SSF	47	452	2.5e-43	PFAM
transmembrane domain	522	544	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium glucose cotransporter family. The encoded protein is responsible for the uptake of iodine in tissues such as the thyroid and lactating breast tissue. The iodine taken up by the thyroid is incorporated into the metabolic regulators triiodothyronine (T3) and tetraiodothyronine (T4). Mutations in this gene are associated with thyroid dyshormonogenesis 1.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced T3 and T4 levels when fed a minimal iodine diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgra2	T	C	8: 27,113,486		probably null	Het
Ahctf1	G	T	1: 179,769,339	H81N	possibly damaging	Het
Alyref2	T	C	1: 171,504,110	S152P	possibly damaging	Het
Arhgef7	C	T	8: 11,785,774	T20I	probably damaging	Het
Armc3	T	G	2: 19,303,799	Y759*	probably null	Het
Atg5	A	G	10: 44,362,987	S255G	probably benign	Het
Atp11b	A	G	3: 35,837,516	I1026V	probably benign	Het
Atp1a2	C	A	1: 172,279,442	K770N	probably damaging	Het
Bptf	G	T	11: 107,111,434	A284E	probably damaging	Het
Celsr2	A	G	3: 108,393,358	S815P	probably benign	Het
Chrna5	A	G	9: 54,998,105	H67R	probably benign	Het
Cic	A	G	7: 25,272,778	I645V	probably benign	Het
Clpx	A	T	9: 65,299,964	Q48L	probably benign	Het
Crhr2	G	A	6: 55,092,100	Q397*	probably null	Het
Cyp11a1	G	A	9: 58,018,225	V48I	probably benign	Het
Dchs1	C	T	7: 105,755,748	R2529H	probably benign	Het
Dnah7c	A	T	1: 46,748,666	H3293L	possibly damaging	Het
Dock6	G	T	9: 21,824,493	D986E	probably benign	Het
Efcab6	T	A	15: 83,904,238	N952Y	probably damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Epg5	G	A	18: 77,986,403	C1327Y	probably damaging	Het
Fbxw18	T	C	9: 109,691,568	E241G	probably benign	Het
Fsd1	T	G	17: 55,990,542		probably benign	Het
Gcnt3	A	G	9: 70,034,270	S339P	probably benign	Het
Gldc	T	A	19: 30,110,772	K829*	probably null	Het
Gli3	G	A	13: 15,478,165		probably null	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Greb1l	G	A	18: 10,542,427	E1341K	probably damaging	Het
Hmcn1	A	T	1: 150,609,666	I4395N	probably damaging	Het
Hmcn1	A	T	1: 150,690,600	C2217*	probably null	Het
Hmgxb3	A	G	18: 61,140,837	M861T	probably benign	Het
Ift172	A	G	5: 31,255,277	S1545P	possibly damaging	Het
Jak3	C	A	8: 71,684,354	L725M	probably damaging	Het
Lrig2	A	T	3: 104,468,615	C90*	probably null	Het
Mcm7	C	T	5: 138,164,819	R357H	possibly damaging	Het
Mcoln2	T	C	3: 146,181,826	S333P	probably damaging	Het
Mrpl22	A	T	11: 58,177,283	I136L	probably benign	Het
Ncam2	A	T	16: 81,589,814		probably null	Het
Ncdn	G	A	4: 126,749,950	Q360*	probably null	Het
Nsun2	A	G	13: 69,623,284	K338E	probably benign	Het
Obscn	T	C	11: 59,036,808	T6105A	probably damaging	Het
Olfr171	G	A	16: 19,624,389	S237F	probably benign	Het
Olfr957	A	T	9: 39,511,042	L226H	probably damaging	Het
Pcnx4	T	A	12: 72,567,194	F638I	possibly damaging	Het
Pfn3	T	C	13: 55,415,040	I43V	probably benign	Het
Pigm	C	A	1: 172,377,445		probably null	Het
Pkhd1l1	T	A	15: 44,545,417	S2433R	probably damaging	Het
Pomt1	C	A	2: 32,248,692	A440D	possibly damaging	Het
Ptprj	T	C	2: 90,458,269	D691G	probably benign	Het
Qrich1	T	A	9: 108,528,823	S72T	probably damaging	Het
Ralgapa2	T	A	2: 146,453,406		probably null	Het
Rarg	A	C	15: 102,241,067	S156A	probably damaging	Het
Rasl11a	A	G	5: 146,847,144	K133R	probably benign	Het
Rcor1	A	G	12: 111,101,635	D158G	probably benign	Het
Rpn2	C	T	2: 157,321,827	T613M	probably damaging	Het
Sipa1l2	T	A	8: 125,491,248	H450L	probably damaging	Het
Slc25a21	T	C	12: 56,718,156	I263V	probably benign	Het
Slc25a32	A	T	15: 39,097,562	V242E	probably benign	Het
Tdrd3	T	C	14: 87,506,440	V608A	probably benign	Het
Thnsl1	C	A	2: 21,212,000	H188Q	possibly damaging	Het
Tshz1	A	T	18: 84,014,524	H586Q	probably damaging	Het
Vmn2r27	C	T	6: 124,192,144	A676T	possibly damaging	Het
Wasf1	G	A	10: 40,926,574	R75Q	probably damaging	Het
Xbp1	T	A	11: 5,521,903	F10I	probably benign	Het
Zbtb1	G	A	12: 76,386,924	M561I	probably benign	Het
Zfp708	T	C	13: 67,070,458	K446E	probably benign	Het

Other mutations in Slc5a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Slc5a5	APN	8	70888537	missense	probably damaging	0.99
IGL01372:Slc5a5	APN	8	70890376	unclassified	probably benign
IGL01394:Slc5a5	APN	8	70889388	nonsense	probably null
IGL01571:Slc5a5	APN	8	70891332	unclassified	probably benign
IGL02043:Slc5a5	APN	8	70892429	missense	possibly damaging	0.84
IGL02186:Slc5a5	APN	8	70886120	missense	possibly damaging	0.79
IGL02479:Slc5a5	APN	8	70888911	missense	possibly damaging	0.67
IGL02559:Slc5a5	APN	8	70890271	missense	probably damaging	1.00
IGL02892:Slc5a5	APN	8	70892517	missense	probably damaging	1.00
IGL03388:Slc5a5	APN	8	70890328	missense	probably benign	0.45
R0234:Slc5a5	UTSW	8	70889633	missense	probably damaging	1.00
R0234:Slc5a5	UTSW	8	70889633	missense	probably damaging	1.00
R0413:Slc5a5	UTSW	8	70891675	missense	possibly damaging	0.63
R0662:Slc5a5	UTSW	8	70883875	missense	probably benign	0.01
R0781:Slc5a5	UTSW	8	70890220	missense	probably benign	0.19
R1061:Slc5a5	UTSW	8	70890221	missense	probably benign	0.00
R1400:Slc5a5	UTSW	8	70889435	missense	possibly damaging	0.87
R1524:Slc5a5	UTSW	8	70892334	missense	probably damaging	1.00
R2033:Slc5a5	UTSW	8	70888587	missense	probably damaging	0.99
R2072:Slc5a5	UTSW	8	70892439	missense	possibly damaging	0.95
R2075:Slc5a5	UTSW	8	70892439	missense	possibly damaging	0.95
R2110:Slc5a5	UTSW	8	70889751	splice site	probably null
R2111:Slc5a5	UTSW	8	70889751	splice site	probably null
R2112:Slc5a5	UTSW	8	70889751	splice site	probably null
R2201:Slc5a5	UTSW	8	70892458	missense	probably damaging	0.98
R3978:Slc5a5	UTSW	8	70889395	missense	probably benign	0.00
R4244:Slc5a5	UTSW	8	70890286	missense	probably benign
R5161:Slc5a5	UTSW	8	70888848	missense	probably damaging	1.00
R5397:Slc5a5	UTSW	8	70891179	missense	probably damaging	1.00
R5740:Slc5a5	UTSW	8	70888917	splice site	probably null
R5869:Slc5a5	UTSW	8	70892330	missense	probably damaging	1.00
R6268:Slc5a5	UTSW	8	70888620	missense	probably damaging	1.00
R6290:Slc5a5	UTSW	8	70891178	missense	probably damaging	1.00
R6292:Slc5a5	UTSW	8	70891178	missense	probably damaging	1.00
R7098:Slc5a5	UTSW	8	70888538	missense	probably damaging	0.99
R7354:Slc5a5	UTSW	8	70889603	missense	probably damaging	1.00
R8777:Slc5a5	UTSW	8	70891290	missense	possibly damaging	0.87
R8777-TAIL:Slc5a5	UTSW	8	70891290	missense	possibly damaging	0.87
R8903:Slc5a5	UTSW	8	70892583	missense	probably damaging	1.00
R9474:Slc5a5	UTSW	8	70884952	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGAACTTGAACGTGGCGTG -3'
(R):5'- CCTGTGAGAGATGAGATCAATGTG -3'

Sequencing Primer
(F):5'- CGAGGGCCTTTGCACAAAC -3'
(R):5'- ATGAGATCAATGTGCCCCG -3'

Posted On

2017-01-03