Incidental Mutation 'R5718:Slc5a5'
ID 451282
Institutional Source Beutler Lab
Gene Symbol Slc5a5
Ensembl Gene ENSMUSG00000000792
Gene Name solute carrier family 5 (sodium iodide symporter), member 5
Synonyms NIS
MMRRC Submission 043338-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5718 (G1)
Quality Score 210
Status Not validated
Chromosome 8
Chromosomal Location 71335533-71345401 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 71340399 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 484 (T484S)
Ref Sequence ENSEMBL: ENSMUSP00000000809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000809]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000000809
AA Change: T484S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000000809
Gene: ENSMUSG00000000792
AA Change: T484S

DomainStartEndE-ValueType
Pfam:SSF 47 452 2.5e-43 PFAM
transmembrane domain 522 544 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium glucose cotransporter family. The encoded protein is responsible for the uptake of iodine in tissues such as the thyroid and lactating breast tissue. The iodine taken up by the thyroid is incorporated into the metabolic regulators triiodothyronine (T3) and tetraiodothyronine (T4). Mutations in this gene are associated with thyroid dyshormonogenesis 1.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced T3 and T4 levels when fed a minimal iodine diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 T C 8: 27,603,514 (GRCm39) probably null Het
Ahctf1 G T 1: 179,596,904 (GRCm39) H81N possibly damaging Het
Alyref2 T C 1: 171,331,678 (GRCm39) S152P possibly damaging Het
Arhgef7 C T 8: 11,835,774 (GRCm39) T20I probably damaging Het
Armc3 T G 2: 19,308,610 (GRCm39) Y759* probably null Het
Atg5 A G 10: 44,238,983 (GRCm39) S255G probably benign Het
Atp11b A G 3: 35,891,665 (GRCm39) I1026V probably benign Het
Atp1a2 C A 1: 172,107,009 (GRCm39) K770N probably damaging Het
Bptf G T 11: 107,002,260 (GRCm39) A284E probably damaging Het
Celsr2 A G 3: 108,300,674 (GRCm39) S815P probably benign Het
Chrna5 A G 9: 54,905,389 (GRCm39) H67R probably benign Het
Cic A G 7: 24,972,203 (GRCm39) I645V probably benign Het
Clpx A T 9: 65,207,246 (GRCm39) Q48L probably benign Het
Crhr2 G A 6: 55,069,085 (GRCm39) Q397* probably null Het
Cyp11a1 G A 9: 57,925,508 (GRCm39) V48I probably benign Het
Dchs1 C T 7: 105,404,955 (GRCm39) R2529H probably benign Het
Dnah7c A T 1: 46,787,826 (GRCm39) H3293L possibly damaging Het
Dock6 G T 9: 21,735,789 (GRCm39) D986E probably benign Het
Efcab6 T A 15: 83,788,439 (GRCm39) N952Y probably damaging Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Epg5 G A 18: 78,029,618 (GRCm39) C1327Y probably damaging Het
Fbxw18 T C 9: 109,520,636 (GRCm39) E241G probably benign Het
Fsd1 T G 17: 56,297,542 (GRCm39) probably benign Het
Gcnt3 A G 9: 69,941,552 (GRCm39) S339P probably benign Het
Gldc T A 19: 30,088,172 (GRCm39) K829* probably null Het
Gli3 G A 13: 15,652,750 (GRCm39) probably null Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Greb1l G A 18: 10,542,427 (GRCm39) E1341K probably damaging Het
Hmcn1 A T 1: 150,566,351 (GRCm39) C2217* probably null Het
Hmcn1 A T 1: 150,485,417 (GRCm39) I4395N probably damaging Het
Hmgxb3 A G 18: 61,273,909 (GRCm39) M861T probably benign Het
Ift172 A G 5: 31,412,621 (GRCm39) S1545P possibly damaging Het
Jak3 C A 8: 72,136,998 (GRCm39) L725M probably damaging Het
Lrig2 A T 3: 104,375,931 (GRCm39) C90* probably null Het
Mcm7 C T 5: 138,163,081 (GRCm39) R357H possibly damaging Het
Mcoln2 T C 3: 145,887,581 (GRCm39) S333P probably damaging Het
Mrpl22 A T 11: 58,068,109 (GRCm39) I136L probably benign Het
Ncam2 A T 16: 81,386,702 (GRCm39) probably null Het
Ncdn G A 4: 126,643,743 (GRCm39) Q360* probably null Het
Nsun2 A G 13: 69,771,403 (GRCm39) K338E probably benign Het
Obscn T C 11: 58,927,634 (GRCm39) T6105A probably damaging Het
Or2aj6 G A 16: 19,443,139 (GRCm39) S237F probably benign Het
Or8g36 A T 9: 39,422,338 (GRCm39) L226H probably damaging Het
Pcnx4 T A 12: 72,613,968 (GRCm39) F638I possibly damaging Het
Pfn3 T C 13: 55,562,853 (GRCm39) I43V probably benign Het
Pigm C A 1: 172,205,012 (GRCm39) probably null Het
Pkhd1l1 T A 15: 44,408,813 (GRCm39) S2433R probably damaging Het
Pomt1 C A 2: 32,138,704 (GRCm39) A440D possibly damaging Het
Ptprj T C 2: 90,288,613 (GRCm39) D691G probably benign Het
Qrich1 T A 9: 108,406,022 (GRCm39) S72T probably damaging Het
Ralgapa2 T A 2: 146,295,326 (GRCm39) probably null Het
Rarg A C 15: 102,149,502 (GRCm39) S156A probably damaging Het
Rasl11a A G 5: 146,783,954 (GRCm39) K133R probably benign Het
Rcor1 A G 12: 111,068,069 (GRCm39) D158G probably benign Het
Rpn2 C T 2: 157,163,747 (GRCm39) T613M probably damaging Het
Sipa1l2 T A 8: 126,217,987 (GRCm39) H450L probably damaging Het
Slc25a21 T C 12: 56,764,941 (GRCm39) I263V probably benign Het
Slc25a32 A T 15: 38,960,957 (GRCm39) V242E probably benign Het
Tdrd3 T C 14: 87,743,876 (GRCm39) V608A probably benign Het
Thnsl1 C A 2: 21,216,811 (GRCm39) H188Q possibly damaging Het
Tshz1 A T 18: 84,032,649 (GRCm39) H586Q probably damaging Het
Vmn2r27 C T 6: 124,169,103 (GRCm39) A676T possibly damaging Het
Wasf1 G A 10: 40,802,570 (GRCm39) R75Q probably damaging Het
Xbp1 T A 11: 5,471,903 (GRCm39) F10I probably benign Het
Zbtb1 G A 12: 76,433,698 (GRCm39) M561I probably benign Het
Zfp708 T C 13: 67,218,522 (GRCm39) K446E probably benign Het
Other mutations in Slc5a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Slc5a5 APN 8 71,341,181 (GRCm39) missense probably damaging 0.99
IGL01372:Slc5a5 APN 8 71,343,020 (GRCm39) unclassified probably benign
IGL01394:Slc5a5 APN 8 71,342,032 (GRCm39) nonsense probably null
IGL01571:Slc5a5 APN 8 71,343,976 (GRCm39) unclassified probably benign
IGL02043:Slc5a5 APN 8 71,345,073 (GRCm39) missense possibly damaging 0.84
IGL02186:Slc5a5 APN 8 71,338,764 (GRCm39) missense possibly damaging 0.79
IGL02479:Slc5a5 APN 8 71,341,555 (GRCm39) missense possibly damaging 0.67
IGL02559:Slc5a5 APN 8 71,342,915 (GRCm39) missense probably damaging 1.00
IGL02892:Slc5a5 APN 8 71,345,161 (GRCm39) missense probably damaging 1.00
IGL03388:Slc5a5 APN 8 71,342,972 (GRCm39) missense probably benign 0.45
R0234:Slc5a5 UTSW 8 71,342,277 (GRCm39) missense probably damaging 1.00
R0234:Slc5a5 UTSW 8 71,342,277 (GRCm39) missense probably damaging 1.00
R0413:Slc5a5 UTSW 8 71,344,319 (GRCm39) missense possibly damaging 0.63
R0662:Slc5a5 UTSW 8 71,336,519 (GRCm39) missense probably benign 0.01
R0781:Slc5a5 UTSW 8 71,342,864 (GRCm39) missense probably benign 0.19
R1061:Slc5a5 UTSW 8 71,342,865 (GRCm39) missense probably benign 0.00
R1400:Slc5a5 UTSW 8 71,342,079 (GRCm39) missense possibly damaging 0.87
R1524:Slc5a5 UTSW 8 71,344,978 (GRCm39) missense probably damaging 1.00
R2033:Slc5a5 UTSW 8 71,341,231 (GRCm39) missense probably damaging 0.99
R2072:Slc5a5 UTSW 8 71,345,083 (GRCm39) missense possibly damaging 0.95
R2075:Slc5a5 UTSW 8 71,345,083 (GRCm39) missense possibly damaging 0.95
R2110:Slc5a5 UTSW 8 71,342,395 (GRCm39) splice site probably null
R2111:Slc5a5 UTSW 8 71,342,395 (GRCm39) splice site probably null
R2112:Slc5a5 UTSW 8 71,342,395 (GRCm39) splice site probably null
R2201:Slc5a5 UTSW 8 71,345,102 (GRCm39) missense probably damaging 0.98
R3978:Slc5a5 UTSW 8 71,342,039 (GRCm39) missense probably benign 0.00
R4244:Slc5a5 UTSW 8 71,342,930 (GRCm39) missense probably benign
R5161:Slc5a5 UTSW 8 71,341,492 (GRCm39) missense probably damaging 1.00
R5397:Slc5a5 UTSW 8 71,343,823 (GRCm39) missense probably damaging 1.00
R5740:Slc5a5 UTSW 8 71,341,561 (GRCm39) splice site probably null
R5869:Slc5a5 UTSW 8 71,344,974 (GRCm39) missense probably damaging 1.00
R6268:Slc5a5 UTSW 8 71,341,264 (GRCm39) missense probably damaging 1.00
R6290:Slc5a5 UTSW 8 71,343,822 (GRCm39) missense probably damaging 1.00
R6292:Slc5a5 UTSW 8 71,343,822 (GRCm39) missense probably damaging 1.00
R7098:Slc5a5 UTSW 8 71,341,182 (GRCm39) missense probably damaging 0.99
R7354:Slc5a5 UTSW 8 71,342,247 (GRCm39) missense probably damaging 1.00
R8777:Slc5a5 UTSW 8 71,343,934 (GRCm39) missense possibly damaging 0.87
R8777-TAIL:Slc5a5 UTSW 8 71,343,934 (GRCm39) missense possibly damaging 0.87
R8903:Slc5a5 UTSW 8 71,345,227 (GRCm39) missense probably damaging 1.00
R9474:Slc5a5 UTSW 8 71,337,596 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAACTTGAACGTGGCGTG -3'
(R):5'- CCTGTGAGAGATGAGATCAATGTG -3'

Sequencing Primer
(F):5'- CGAGGGCCTTTGCACAAAC -3'
(R):5'- ATGAGATCAATGTGCCCCG -3'
Posted On 2017-01-03