Incidental Mutation 'R5718:Dock6'
ID451285
Institutional Source Beutler Lab
Gene Symbol Dock6
Ensembl Gene ENSMUSG00000032198
Gene Namededicator of cytokinesis 6
Synonyms2410095B20Rik, C330023D02Rik, 4931431C02Rik
MMRRC Submission 043338-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.391) question?
Stock #R5718 (G1)
Quality Score210
Status Not validated
Chromosome9
Chromosomal Location21799860-21852635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 21824493 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 986 (D986E)
Ref Sequence ENSEMBL: ENSMUSP00000034728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034728] [ENSMUST00000217336]
Predicted Effect probably benign
Transcript: ENSMUST00000034728
AA Change: D986E

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000034728
Gene: ENSMUSG00000032198
AA Change: D986E

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
Pfam:DUF3398 63 155 4.7e-26 PFAM
low complexity region 419 429 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
Pfam:DOCK-C2 542 721 3.4e-46 PFAM
low complexity region 754 770 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 945 965 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
low complexity region 1123 1153 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1340 1356 N/A INTRINSIC
Pfam:DHR-2 1554 2080 6.6e-214 PFAM
low complexity region 2093 2107 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000216626
AA Change: D431E
Predicted Effect probably benign
Transcript: ENSMUST00000217336
AA Change: D1017E

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217515
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis (DOCK) family of atypical guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with small GTPases and are components of intracellular signaling networks. The encoded protein is a group C DOCK protein and plays a role in actin cytoskeletal reorganization by activating the Rho GTPases Cdc42 and Rac1. Mutations in this gene are associated with Adams-Oliver syndrome 2. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 T C 8: 27,113,486 probably null Het
Ahctf1 G T 1: 179,769,339 H81N possibly damaging Het
Alyref2 T C 1: 171,504,110 S152P possibly damaging Het
Arhgef7 C T 8: 11,785,774 T20I probably damaging Het
Armc3 T G 2: 19,303,799 Y759* probably null Het
Atg5 A G 10: 44,362,987 S255G probably benign Het
Atp11b A G 3: 35,837,516 I1026V probably benign Het
Atp1a2 C A 1: 172,279,442 K770N probably damaging Het
Bptf G T 11: 107,111,434 A284E probably damaging Het
Celsr2 A G 3: 108,393,358 S815P probably benign Het
Chrna5 A G 9: 54,998,105 H67R probably benign Het
Cic A G 7: 25,272,778 I645V probably benign Het
Clpx A T 9: 65,299,964 Q48L probably benign Het
Crhr2 G A 6: 55,092,100 Q397* probably null Het
Cyp11a1 G A 9: 58,018,225 V48I probably benign Het
Dchs1 C T 7: 105,755,748 R2529H probably benign Het
Dnah7c A T 1: 46,748,666 H3293L possibly damaging Het
Efcab6 T A 15: 83,904,238 N952Y probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epg5 G A 18: 77,986,403 C1327Y probably damaging Het
Fbxw18 T C 9: 109,691,568 E241G probably benign Het
Fsd1 T G 17: 55,990,542 probably benign Het
Gcnt3 A G 9: 70,034,270 S339P probably benign Het
Gldc T A 19: 30,110,772 K829* probably null Het
Gli3 G A 13: 15,478,165 probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Hmcn1 A T 1: 150,609,666 I4395N probably damaging Het
Hmcn1 A T 1: 150,690,600 C2217* probably null Het
Hmgxb3 A G 18: 61,140,837 M861T probably benign Het
Ift172 A G 5: 31,255,277 S1545P possibly damaging Het
Jak3 C A 8: 71,684,354 L725M probably damaging Het
Lrig2 A T 3: 104,468,615 C90* probably null Het
Mcm7 C T 5: 138,164,819 R357H possibly damaging Het
Mcoln2 T C 3: 146,181,826 S333P probably damaging Het
Mrpl22 A T 11: 58,177,283 I136L probably benign Het
Ncam2 A T 16: 81,589,814 probably null Het
Ncdn G A 4: 126,749,950 Q360* probably null Het
Nsun2 A G 13: 69,623,284 K338E probably benign Het
Obscn T C 11: 59,036,808 T6105A probably damaging Het
Olfr171 G A 16: 19,624,389 S237F probably benign Het
Olfr957 A T 9: 39,511,042 L226H probably damaging Het
Pcnx4 T A 12: 72,567,194 F638I possibly damaging Het
Pfn3 T C 13: 55,415,040 I43V probably benign Het
Pigm C A 1: 172,377,445 probably null Het
Pkhd1l1 T A 15: 44,545,417 S2433R probably damaging Het
Pomt1 C A 2: 32,248,692 A440D possibly damaging Het
Ptprj T C 2: 90,458,269 D691G probably benign Het
Qrich1 T A 9: 108,528,823 S72T probably damaging Het
Ralgapa2 T A 2: 146,453,406 probably null Het
Rarg A C 15: 102,241,067 S156A probably damaging Het
Rasl11a A G 5: 146,847,144 K133R probably benign Het
Rcor1 A G 12: 111,101,635 D158G probably benign Het
Rpn2 C T 2: 157,321,827 T613M probably damaging Het
Sipa1l2 T A 8: 125,491,248 H450L probably damaging Het
Slc25a21 T C 12: 56,718,156 I263V probably benign Het
Slc25a32 A T 15: 39,097,562 V242E probably benign Het
Slc5a5 T A 8: 70,887,755 T484S probably benign Het
Tdrd3 T C 14: 87,506,440 V608A probably benign Het
Thnsl1 C A 2: 21,212,000 H188Q possibly damaging Het
Tshz1 A T 18: 84,014,524 H586Q probably damaging Het
Vmn2r27 C T 6: 124,192,144 A676T possibly damaging Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Xbp1 T A 11: 5,521,903 F10I probably benign Het
Zbtb1 G A 12: 76,386,924 M561I probably benign Het
Zfp708 T C 13: 67,070,458 K446E probably benign Het
Other mutations in Dock6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Dock6 APN 9 21846634 missense possibly damaging 0.50
IGL01025:Dock6 APN 9 21811807 missense possibly damaging 0.89
IGL01390:Dock6 APN 9 21803045 missense probably damaging 1.00
IGL02025:Dock6 APN 9 21809589 missense probably damaging 0.98
IGL02028:Dock6 APN 9 21838826 missense probably damaging 1.00
IGL02311:Dock6 APN 9 21844328 missense probably damaging 1.00
IGL02441:Dock6 APN 9 21841926 missense possibly damaging 0.77
IGL02504:Dock6 APN 9 21846655 missense probably benign 0.19
IGL02516:Dock6 APN 9 21802585 missense probably damaging 1.00
IGL02836:Dock6 APN 9 21801864 missense probably damaging 1.00
IGL02894:Dock6 APN 9 21811815 missense probably damaging 1.00
bayfront UTSW 9 21821745 missense probably benign 0.29
IGL03048:Dock6 UTSW 9 21809570 missense probably damaging 1.00
R0370:Dock6 UTSW 9 21814565 missense probably benign 0.29
R0504:Dock6 UTSW 9 21802436 missense probably damaging 1.00
R0633:Dock6 UTSW 9 21844417 missense probably benign 0.00
R0634:Dock6 UTSW 9 21841527 missense probably damaging 1.00
R0671:Dock6 UTSW 9 21804627 splice site probably benign
R0839:Dock6 UTSW 9 21817892 missense probably benign 0.01
R0948:Dock6 UTSW 9 21801533 missense probably damaging 1.00
R1022:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1024:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1073:Dock6 UTSW 9 21846518 missense probably benign
R1463:Dock6 UTSW 9 21831906 missense probably damaging 1.00
R1481:Dock6 UTSW 9 21820622 missense probably benign
R1494:Dock6 UTSW 9 21814742 missense probably benign 0.34
R1547:Dock6 UTSW 9 21814588 missense probably damaging 1.00
R1654:Dock6 UTSW 9 21804843 missense probably damaging 0.98
R1782:Dock6 UTSW 9 21811846 missense probably damaging 1.00
R1905:Dock6 UTSW 9 21829574 missense probably benign 0.37
R1908:Dock6 UTSW 9 21841629 missense probably damaging 1.00
R1916:Dock6 UTSW 9 21813091 missense probably damaging 1.00
R2132:Dock6 UTSW 9 21846518 missense probably benign
R2197:Dock6 UTSW 9 21832881 missense probably damaging 1.00
R2316:Dock6 UTSW 9 21839677 missense probably damaging 0.98
R2341:Dock6 UTSW 9 21839486 splice site probably benign
R2519:Dock6 UTSW 9 21816333 missense possibly damaging 0.54
R2924:Dock6 UTSW 9 21809630 missense probably damaging 1.00
R2939:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R2940:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3078:Dock6 UTSW 9 21845754 splice site probably benign
R3081:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3810:Dock6 UTSW 9 21801577 missense probably damaging 1.00
R4246:Dock6 UTSW 9 21839490 splice site probably null
R4604:Dock6 UTSW 9 21802540 missense probably damaging 1.00
R4833:Dock6 UTSW 9 21844280 missense probably damaging 1.00
R4849:Dock6 UTSW 9 21811772 critical splice donor site probably null
R4896:Dock6 UTSW 9 21824437 missense possibly damaging 0.48
R4926:Dock6 UTSW 9 21845791 missense probably damaging 1.00
R5183:Dock6 UTSW 9 21841603 missense probably benign 0.00
R5211:Dock6 UTSW 9 21820352 missense probably benign 0.36
R5337:Dock6 UTSW 9 21829548 missense possibly damaging 0.93
R5353:Dock6 UTSW 9 21814786 missense probably benign 0.00
R5429:Dock6 UTSW 9 21832881 missense probably damaging 0.99
R5463:Dock6 UTSW 9 21809958 intron probably null
R5476:Dock6 UTSW 9 21809589 missense probably damaging 0.98
R5511:Dock6 UTSW 9 21817407 missense possibly damaging 0.59
R5534:Dock6 UTSW 9 21803076 nonsense probably null
R5823:Dock6 UTSW 9 21804828 missense probably damaging 0.99
R5831:Dock6 UTSW 9 21803036 missense probably damaging 1.00
R5887:Dock6 UTSW 9 21820394 missense probably damaging 0.96
R5930:Dock6 UTSW 9 21824416 missense probably benign 0.29
R6159:Dock6 UTSW 9 21821745 missense probably benign 0.29
R6633:Dock6 UTSW 9 21820331 missense probably benign 0.17
R6633:Dock6 UTSW 9 21821503 missense probably damaging 1.00
R6665:Dock6 UTSW 9 21839912 missense probably damaging 0.99
R6744:Dock6 UTSW 9 21831474 missense probably damaging 1.00
R6903:Dock6 UTSW 9 21809564 missense probably damaging 1.00
R6981:Dock6 UTSW 9 21845550 missense probably damaging 0.99
R7024:Dock6 UTSW 9 21820370 missense probably benign
R7030:Dock6 UTSW 9 21813079 missense probably damaging 1.00
R7045:Dock6 UTSW 9 21821811 missense probably damaging 1.00
R7139:Dock6 UTSW 9 21801276 missense probably damaging 1.00
R7356:Dock6 UTSW 9 21809899 missense probably damaging 1.00
R7400:Dock6 UTSW 9 21801807 missense possibly damaging 0.62
R7847:Dock6 UTSW 9 21801207 missense unknown
R7863:Dock6 UTSW 9 21846658 missense possibly damaging 0.85
R7930:Dock6 UTSW 9 21801207 missense unknown
R7946:Dock6 UTSW 9 21846658 missense possibly damaging 0.85
R8012:Dock6 UTSW 9 21846511 missense probably benign 0.16
R8184:Dock6 UTSW 9 21830300 missense possibly damaging 0.54
R8213:Dock6 UTSW 9 21831444 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ATGGATGAACAGACCCACGTG -3'
(R):5'- TGTCAAATCCAGATCACCTTTTAGC -3'

Sequencing Primer
(F):5'- TGGCACACTGGATCCCTGAC -3'
(R):5'- TAGCTACAACTGCTTAGCTCAGGG -3'
Posted On2017-01-03