Incidental Mutation 'R0550:Fshr'
ID45129
Institutional Source Beutler Lab
Gene Symbol Fshr
Ensembl Gene ENSMUSG00000032937
Gene Namefollicle stimulating hormone receptor
SynonymsFSH-R, Follitropin receptor, follicle-stimulating hormone receptor
MMRRC Submission 038742-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0550 (G1)
Quality Score186
Status Validated
Chromosome17
Chromosomal Location88985170-89200612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89045125 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 107 (N107S)
Ref Sequence ENSEMBL: ENSMUSP00000040477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035701]
Predicted Effect probably benign
Transcript: ENSMUST00000035701
AA Change: N107S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000040477
Gene: ENSMUSG00000032937
AA Change: N107S

DomainStartEndE-ValueType
LRRNT 17 50 3.93e-3 SMART
Pfam:LRR_5 134 249 9e-7 PFAM
Pfam:GnHR_trans 282 348 4.6e-27 PFAM
Pfam:7tm_1 378 625 1.9e-30 PFAM
Meta Mutation Damage Score 0.1875 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to family 1 of G-protein coupled receptors. It is the receptor for follicle stimulating hormone and functions in gonad development. Mutations in this gene cause ovarian dysgenesis type 1, and also ovarian hyperstimulation syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous null mutant females are sterile with small ovaries, blocked follicular development, atrophic uterus and imperforate vagina. Mutant males are fertile despite reduction in testis weight, oligozoospermia and reduced testosterone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,293,840 Y947N probably damaging Het
Acss3 C A 10: 107,053,471 G163C probably damaging Het
Adcy10 A G 1: 165,565,315 T1367A probably benign Het
Adcy2 A T 13: 68,982,361 S136T probably benign Het
Ahdc1 G A 4: 133,063,037 V530I probably benign Het
Aldh16a1 C T 7: 45,146,229 probably null Het
Ankrd36 T C 11: 5,607,429 probably null Het
Aqr A C 2: 114,132,976 N664K probably damaging Het
Atp6v1c1 T C 15: 38,682,929 probably benign Het
Atp8b2 C T 3: 89,959,061 probably benign Het
Bbx T C 16: 50,274,533 probably benign Het
Bmper T A 9: 23,373,885 D243E probably benign Het
Casz1 GCCACCACCACCACCACCACCAC GCCACCACCACCACCACCAC 4: 148,952,284 probably benign Het
Catsperd T C 17: 56,663,427 probably null Het
Ccdc92b T A 11: 74,629,945 probably null Het
Cd2bp2 G T 7: 127,193,824 T342K probably damaging Het
Clrn3 T A 7: 135,528,425 I27F possibly damaging Het
Cnih3 TTGACGAG T 1: 181,406,477 probably null Het
Cntnap3 T C 13: 64,762,000 T764A possibly damaging Het
Cttnbp2 T G 6: 18,435,309 K183N possibly damaging Het
Cwc27 G A 13: 104,804,949 P155L probably damaging Het
Dcaf10 T C 4: 45,372,753 S389P probably benign Het
Ddx18 T C 1: 121,555,375 K561E probably benign Het
Dkk3 A G 7: 112,158,245 F51L probably damaging Het
Dnaic1 C T 4: 41,596,274 R20* probably null Het
Dr1 G A 5: 108,269,605 G6S probably benign Het
Dync2h1 A T 9: 7,120,954 probably null Het
Eif3l A G 15: 79,076,867 Y16C probably damaging Het
Epb41 A G 4: 131,975,613 I464T probably damaging Het
Erc2 A G 14: 28,271,651 K546E possibly damaging Het
F830045P16Rik T C 2: 129,463,509 D315G probably damaging Het
Fads6 A G 11: 115,296,677 I64T probably benign Het
Gbp11 A T 5: 105,343,750 N60K probably benign Het
Gm2a C T 11: 55,103,665 Q54* probably null Het
Hydin A G 8: 110,587,775 D4297G probably benign Het
Il6st G A 13: 112,475,114 probably null Het
Inpp4b T A 8: 81,997,337 H499Q probably benign Het
Kif5c A G 2: 49,758,912 K956R possibly damaging Het
Krt74 G A 15: 101,760,679 noncoding transcript Het
Map3k9 A T 12: 81,725,781 L649Q probably damaging Het
Mdn1 A G 4: 32,730,479 D2871G probably benign Het
Mylk4 T C 13: 32,716,666 T294A probably benign Het
Nbeal2 C T 9: 110,642,158 V252I probably benign Het
Nectin3 A G 16: 46,458,820 I265T possibly damaging Het
Olfr1065 A T 2: 86,445,876 Y35* probably null Het
Olfr1109 G T 2: 87,093,129 H89Q probably benign Het
Olfr1259 A G 2: 89,943,389 I242T probably damaging Het
Olfr1447 A T 19: 12,901,800 probably null Het
Olfr181 A G 16: 58,926,385 F62S probably damaging Het
Olfr554 G A 7: 102,640,950 E235K possibly damaging Het
Olfr910 T A 9: 38,539,380 C162S probably damaging Het
Opn1sw A T 6: 29,380,204 L71Q probably damaging Het
Pced1a G A 2: 130,419,633 P367S probably benign Het
Pkhd1 A T 1: 20,347,223 M2568K probably null Het
Pla2r1 A G 2: 60,425,350 probably null Het
Plpp1 T C 13: 112,834,985 I62T probably benign Het
Polr3g G A 13: 81,694,773 T41I probably damaging Het
Ptch2 T C 4: 117,096,433 probably benign Het
Sema4g A T 19: 44,997,665 H315L probably benign Het
Setd1b G T 5: 123,157,660 S1097I unknown Het
Sfxn4 A G 19: 60,850,945 probably benign Het
Sh3tc1 T C 5: 35,699,784 E1237G probably damaging Het
Slc25a38 A T 9: 120,123,643 N287I probably benign Het
Slc25a48 A G 13: 56,448,998 T31A probably benign Het
Slc6a12 G A 6: 121,356,918 V238I probably damaging Het
Slc8b1 A G 5: 120,531,155 probably benign Het
Slco4c1 A C 1: 96,867,859 V158G probably damaging Het
Sptbn4 T C 7: 27,364,378 T2208A probably benign Het
Srebf1 G A 11: 60,201,676 T843I probably benign Het
Srl A G 16: 4,487,565 W101R probably damaging Het
St6galnac4 T A 2: 32,594,019 C76* probably null Het
Tdrd3 C A 14: 87,486,220 T290K probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trpm3 A G 19: 22,987,812 E1547G probably damaging Het
Ubn1 A G 16: 5,062,620 probably null Het
Usp10 T A 8: 119,947,801 I456K probably damaging Het
Usp6nl A G 2: 6,400,323 probably benign Het
Vit T A 17: 78,624,793 V443E possibly damaging Het
Whamm G A 7: 81,586,224 V392I possibly damaging Het
Zfhx4 A G 3: 5,400,494 K1904R probably damaging Het
Zfp352 A T 4: 90,224,690 T356S probably damaging Het
Other mutations in Fshr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Fshr APN 17 88986191 missense probably damaging 1.00
IGL00272:Fshr APN 17 88985271 missense probably benign 0.00
IGL01067:Fshr APN 17 88985393 missense possibly damaging 0.95
IGL02093:Fshr APN 17 89001889 splice site probably null
IGL03184:Fshr APN 17 89046640 missense possibly damaging 0.80
IGL03383:Fshr APN 17 89046699 missense possibly damaging 0.69
IGL03383:Fshr APN 17 88985693 missense probably damaging 0.98
benedict UTSW 17 88985469 missense probably damaging 1.00
incremental UTSW 17 88985986 missense probably damaging 1.00
positively UTSW 17 88988607 missense probably damaging 1.00
R0056:Fshr UTSW 17 88988457 missense probably damaging 1.00
R0119:Fshr UTSW 17 89009285 missense probably benign 0.34
R0299:Fshr UTSW 17 89009285 missense probably benign 0.34
R0499:Fshr UTSW 17 89009285 missense probably benign 0.34
R1499:Fshr UTSW 17 88986101 missense probably damaging 1.00
R1656:Fshr UTSW 17 89200581 missense unknown
R2435:Fshr UTSW 17 89200596 missense unknown
R3730:Fshr UTSW 17 89001715 missense probably benign 0.00
R3928:Fshr UTSW 17 88985534 missense probably damaging 1.00
R4065:Fshr UTSW 17 88985966 missense probably damaging 1.00
R4625:Fshr UTSW 17 88985720 missense probably damaging 1.00
R5062:Fshr UTSW 17 88986046 nonsense probably null
R5103:Fshr UTSW 17 89097368 missense possibly damaging 0.88
R5212:Fshr UTSW 17 88986256 missense probably benign 0.00
R5212:Fshr UTSW 17 88986257 missense probably benign 0.04
R5311:Fshr UTSW 17 89011013 critical splice donor site probably null
R5456:Fshr UTSW 17 88986348 missense probably benign
R5478:Fshr UTSW 17 89001715 missense probably benign 0.00
R5577:Fshr UTSW 17 88985923 missense probably benign 0.00
R5651:Fshr UTSW 17 88985829 missense possibly damaging 0.62
R5715:Fshr UTSW 17 88986396 critical splice acceptor site probably null
R5750:Fshr UTSW 17 88986241 missense probably benign 0.01
R5797:Fshr UTSW 17 89011075 missense probably damaging 1.00
R6041:Fshr UTSW 17 88985986 missense probably damaging 1.00
R6306:Fshr UTSW 17 89200533 missense probably null 0.00
R6589:Fshr UTSW 17 88988607 missense probably damaging 1.00
R6955:Fshr UTSW 17 88985466 missense probably benign 0.00
R7080:Fshr UTSW 17 89097111 intron probably null
R7139:Fshr UTSW 17 88986161 missense possibly damaging 0.46
R7196:Fshr UTSW 17 88985469 missense probably damaging 1.00
R7197:Fshr UTSW 17 88985469 missense probably damaging 1.00
R7289:Fshr UTSW 17 88985844 missense probably benign 0.35
R7480:Fshr UTSW 17 88985374 nonsense probably null
R7562:Fshr UTSW 17 88988497 missense probably damaging 1.00
R7710:Fshr UTSW 17 88985255 missense probably benign 0.00
R7742:Fshr UTSW 17 88986162 missense probably benign
R7821:Fshr UTSW 17 88986213 missense probably damaging 0.99
R8043:Fshr UTSW 17 88986390 missense probably benign 0.06
Z1176:Fshr UTSW 17 89046667 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTAGACAGTTTGTGTGACAACCCTG -3'
(R):5'- GCATGGATGCATGGATGCATGGATG -3'

Sequencing Primer
(F):5'- GTGTGACAACCCTGTAAATGTG -3'
(R):5'- ggatggatgcatggatagatatatgg -3'
Posted On2013-06-11