Incidental Mutation 'R5718:Gcnt3'
ID451290
Institutional Source Beutler Lab
Gene Symbol Gcnt3
Ensembl Gene ENSMUSG00000032226
Gene Nameglucosaminyl (N-acetyl) transferase 3, mucin type
Synonyms2010013H22Rik, 2210021I22Rik, 2210401J11Rik
MMRRC Submission 043338-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5718 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location70031496-70038088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70034270 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 339 (S339P)
Ref Sequence ENSEMBL: ENSMUSP00000034751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034751]
Predicted Effect probably benign
Transcript: ENSMUST00000034751
AA Change: S339P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034751
Gene: ENSMUSG00000032226
AA Change: S339P

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:Branch 133 401 2.1e-63 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the N-acetylglucosaminyltransferase family. The encoded protein is a beta-6-N-acetylglucosamine-transferase that catalyzes the formation of core 2 and core 4 O-glycans on mucin-type glycoproteins.[provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygote null mice have decreases in core 2 O-glycan structures on cell surfaces, decreased immunoglobulin levels, and disrupted mucosal barrier in the intestines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 T C 8: 27,113,486 probably null Het
Ahctf1 G T 1: 179,769,339 H81N possibly damaging Het
Alyref2 T C 1: 171,504,110 S152P possibly damaging Het
Arhgef7 C T 8: 11,785,774 T20I probably damaging Het
Armc3 T G 2: 19,303,799 Y759* probably null Het
Atg5 A G 10: 44,362,987 S255G probably benign Het
Atp11b A G 3: 35,837,516 I1026V probably benign Het
Atp1a2 C A 1: 172,279,442 K770N probably damaging Het
Bptf G T 11: 107,111,434 A284E probably damaging Het
Celsr2 A G 3: 108,393,358 S815P probably benign Het
Chrna5 A G 9: 54,998,105 H67R probably benign Het
Cic A G 7: 25,272,778 I645V probably benign Het
Clpx A T 9: 65,299,964 Q48L probably benign Het
Crhr2 G A 6: 55,092,100 Q397* probably null Het
Cyp11a1 G A 9: 58,018,225 V48I probably benign Het
Dchs1 C T 7: 105,755,748 R2529H probably benign Het
Dnah7c A T 1: 46,748,666 H3293L possibly damaging Het
Dock6 G T 9: 21,824,493 D986E probably benign Het
Efcab6 T A 15: 83,904,238 N952Y probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epg5 G A 18: 77,986,403 C1327Y probably damaging Het
Fbxw18 T C 9: 109,691,568 E241G probably benign Het
Fsd1 T G 17: 55,990,542 probably benign Het
Gldc T A 19: 30,110,772 K829* probably null Het
Gli3 G A 13: 15,478,165 probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Hmcn1 A T 1: 150,690,600 C2217* probably null Het
Hmcn1 A T 1: 150,609,666 I4395N probably damaging Het
Hmgxb3 A G 18: 61,140,837 M861T probably benign Het
Ift172 A G 5: 31,255,277 S1545P possibly damaging Het
Jak3 C A 8: 71,684,354 L725M probably damaging Het
Lrig2 A T 3: 104,468,615 C90* probably null Het
Mcm7 C T 5: 138,164,819 R357H possibly damaging Het
Mcoln2 T C 3: 146,181,826 S333P probably damaging Het
Mrpl22 A T 11: 58,177,283 I136L probably benign Het
Ncam2 A T 16: 81,589,814 probably null Het
Ncdn G A 4: 126,749,950 Q360* probably null Het
Nsun2 A G 13: 69,623,284 K338E probably benign Het
Obscn T C 11: 59,036,808 T6105A probably damaging Het
Olfr171 G A 16: 19,624,389 S237F probably benign Het
Olfr957 A T 9: 39,511,042 L226H probably damaging Het
Pcnx4 T A 12: 72,567,194 F638I possibly damaging Het
Pfn3 T C 13: 55,415,040 I43V probably benign Het
Pigm C A 1: 172,377,445 probably null Het
Pkhd1l1 T A 15: 44,545,417 S2433R probably damaging Het
Pomt1 C A 2: 32,248,692 A440D possibly damaging Het
Ptprj T C 2: 90,458,269 D691G probably benign Het
Qrich1 T A 9: 108,528,823 S72T probably damaging Het
Ralgapa2 T A 2: 146,453,406 probably null Het
Rarg A C 15: 102,241,067 S156A probably damaging Het
Rasl11a A G 5: 146,847,144 K133R probably benign Het
Rcor1 A G 12: 111,101,635 D158G probably benign Het
Rpn2 C T 2: 157,321,827 T613M probably damaging Het
Sipa1l2 T A 8: 125,491,248 H450L probably damaging Het
Slc25a21 T C 12: 56,718,156 I263V probably benign Het
Slc25a32 A T 15: 39,097,562 V242E probably benign Het
Slc5a5 T A 8: 70,887,755 T484S probably benign Het
Tdrd3 T C 14: 87,506,440 V608A probably benign Het
Thnsl1 C A 2: 21,212,000 H188Q possibly damaging Het
Tshz1 A T 18: 84,014,524 H586Q probably damaging Het
Vmn2r27 C T 6: 124,192,144 A676T possibly damaging Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Xbp1 T A 11: 5,521,903 F10I probably benign Het
Zbtb1 G A 12: 76,386,924 M561I probably benign Het
Zfp708 T C 13: 67,070,458 K446E probably benign Het
Other mutations in Gcnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01415:Gcnt3 APN 9 70034457 missense probably benign 0.20
IGL02617:Gcnt3 APN 9 70034162 missense probably damaging 1.00
IGL02965:Gcnt3 APN 9 70034953 missense probably benign 0.00
IGL03113:Gcnt3 APN 9 70034701 missense probably damaging 1.00
IGL03374:Gcnt3 APN 9 70034413 missense possibly damaging 0.89
PIT4131001:Gcnt3 UTSW 9 70034044 missense possibly damaging 0.80
R0012:Gcnt3 UTSW 9 70034085 missense probably benign 0.04
R0012:Gcnt3 UTSW 9 70034085 missense probably benign 0.04
R1241:Gcnt3 UTSW 9 70034333 missense probably benign 0.01
R1653:Gcnt3 UTSW 9 70035077 missense probably damaging 1.00
R1662:Gcnt3 UTSW 9 70034377 missense probably benign 0.00
R2213:Gcnt3 UTSW 9 70034707 missense probably benign 0.16
R4588:Gcnt3 UTSW 9 70034230 missense probably damaging 1.00
R4927:Gcnt3 UTSW 9 70035182 missense probably damaging 1.00
R5407:Gcnt3 UTSW 9 70034189 missense probably benign 0.00
R6974:Gcnt3 UTSW 9 70034887 missense probably damaging 1.00
R7883:Gcnt3 UTSW 9 70034171 missense probably damaging 0.97
R8215:Gcnt3 UTSW 9 70034173 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAAGAGGTGATGGTTCTG -3'
(R):5'- TGCACATGACCAGCAAGAG -3'

Sequencing Primer
(F):5'- TCTGAAGTATCCAGTGCAGGTCC -3'
(R):5'- CAAGAGGAAGACGCCGCC -3'
Posted On2017-01-03