Incidental Mutation 'R5718:Atg5'
ID451295
Institutional Source Beutler Lab
Gene Symbol Atg5
Ensembl Gene ENSMUSG00000038160
Gene Nameautophagy related 5
SynonymsPaddy, 3110067M24Rik, Apg5l, 2010107M05Rik
MMRRC Submission 043338-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5718 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location44268358-44364291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44362987 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 255 (S255G)
Ref Sequence ENSEMBL: ENSMUSP00000044769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039286]
Predicted Effect probably benign
Transcript: ENSMUST00000039286
AA Change: S255G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000044769
Gene: ENSMUSG00000038160
AA Change: S255G

DomainStartEndE-ValueType
Pfam:APG5 79 270 2.6e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158635
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene, in combination with autophagy protein 12, functions as an E1-like activating enzyme in a ubiquitin-like conjugating system. The encoded protein is involved in several cellular processes, including autophagic vesicle formation, mitochondrial quality control after oxidative damage, negative regulation of the innate antiviral immune response, lymphocyte development and proliferation, MHC II antigen presentation, adipocyte differentiation, and apoptosis. Two transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutation of this gene results in impaired autophagy due to absence of autolysosomes. Homozygotes die within 1 day of birth, have shorter survival times and reduced amino acid levels under fasting conditions. Homozygotes for a gene trap insertion mutationin this gene show no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 T C 8: 27,113,486 probably null Het
Ahctf1 G T 1: 179,769,339 H81N possibly damaging Het
Alyref2 T C 1: 171,504,110 S152P possibly damaging Het
Arhgef7 C T 8: 11,785,774 T20I probably damaging Het
Armc3 T G 2: 19,303,799 Y759* probably null Het
Atp11b A G 3: 35,837,516 I1026V probably benign Het
Atp1a2 C A 1: 172,279,442 K770N probably damaging Het
Bptf G T 11: 107,111,434 A284E probably damaging Het
Celsr2 A G 3: 108,393,358 S815P probably benign Het
Chrna5 A G 9: 54,998,105 H67R probably benign Het
Cic A G 7: 25,272,778 I645V probably benign Het
Clpx A T 9: 65,299,964 Q48L probably benign Het
Crhr2 G A 6: 55,092,100 Q397* probably null Het
Cyp11a1 G A 9: 58,018,225 V48I probably benign Het
Dchs1 C T 7: 105,755,748 R2529H probably benign Het
Dnah7c A T 1: 46,748,666 H3293L possibly damaging Het
Dock6 G T 9: 21,824,493 D986E probably benign Het
Efcab6 T A 15: 83,904,238 N952Y probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epg5 G A 18: 77,986,403 C1327Y probably damaging Het
Fbxw18 T C 9: 109,691,568 E241G probably benign Het
Fsd1 T G 17: 55,990,542 probably benign Het
Gcnt3 A G 9: 70,034,270 S339P probably benign Het
Gldc T A 19: 30,110,772 K829* probably null Het
Gli3 G A 13: 15,478,165 probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Hmcn1 A T 1: 150,609,666 I4395N probably damaging Het
Hmcn1 A T 1: 150,690,600 C2217* probably null Het
Hmgxb3 A G 18: 61,140,837 M861T probably benign Het
Ift172 A G 5: 31,255,277 S1545P possibly damaging Het
Jak3 C A 8: 71,684,354 L725M probably damaging Het
Lrig2 A T 3: 104,468,615 C90* probably null Het
Mcm7 C T 5: 138,164,819 R357H possibly damaging Het
Mcoln2 T C 3: 146,181,826 S333P probably damaging Het
Mrpl22 A T 11: 58,177,283 I136L probably benign Het
Ncam2 A T 16: 81,589,814 probably null Het
Ncdn G A 4: 126,749,950 Q360* probably null Het
Nsun2 A G 13: 69,623,284 K338E probably benign Het
Obscn T C 11: 59,036,808 T6105A probably damaging Het
Olfr171 G A 16: 19,624,389 S237F probably benign Het
Olfr957 A T 9: 39,511,042 L226H probably damaging Het
Pcnx4 T A 12: 72,567,194 F638I possibly damaging Het
Pfn3 T C 13: 55,415,040 I43V probably benign Het
Pigm C A 1: 172,377,445 probably null Het
Pkhd1l1 T A 15: 44,545,417 S2433R probably damaging Het
Pomt1 C A 2: 32,248,692 A440D possibly damaging Het
Ptprj T C 2: 90,458,269 D691G probably benign Het
Qrich1 T A 9: 108,528,823 S72T probably damaging Het
Ralgapa2 T A 2: 146,453,406 probably null Het
Rarg A C 15: 102,241,067 S156A probably damaging Het
Rasl11a A G 5: 146,847,144 K133R probably benign Het
Rcor1 A G 12: 111,101,635 D158G probably benign Het
Rpn2 C T 2: 157,321,827 T613M probably damaging Het
Sipa1l2 T A 8: 125,491,248 H450L probably damaging Het
Slc25a21 T C 12: 56,718,156 I263V probably benign Het
Slc25a32 A T 15: 39,097,562 V242E probably benign Het
Slc5a5 T A 8: 70,887,755 T484S probably benign Het
Tdrd3 T C 14: 87,506,440 V608A probably benign Het
Thnsl1 C A 2: 21,212,000 H188Q possibly damaging Het
Tshz1 A T 18: 84,014,524 H586Q probably damaging Het
Vmn2r27 C T 6: 124,192,144 A676T possibly damaging Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Xbp1 T A 11: 5,521,903 F10I probably benign Het
Zbtb1 G A 12: 76,386,924 M561I probably benign Het
Zfp708 T C 13: 67,070,458 K446E probably benign Het
Other mutations in Atg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Atg5 APN 10 44363044 missense probably benign 0.00
P0041:Atg5 UTSW 10 44289942 missense probably benign 0.20
R2094:Atg5 UTSW 10 44319548 missense probably damaging 1.00
R4906:Atg5 UTSW 10 44363050 makesense probably null
R6194:Atg5 UTSW 10 44294616 missense probably damaging 1.00
R6660:Atg5 UTSW 10 44294655 missense probably benign
R7070:Atg5 UTSW 10 44286154 missense probably damaging 1.00
R7677:Atg5 UTSW 10 44347039 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCCTGTTGAGGGGATAGAACAAG -3'
(R):5'- GCGCCCTATCTCTCATGGAATC -3'

Sequencing Primer
(F):5'- GGGGATAGAACAAGTTTGAAATCC -3'
(R):5'- ATGGAATCTTCTCCTCCTTGGCTTG -3'
Posted On2017-01-03