Mutagenetix > Incidental Mutation

Incidental Mutation 'R0550:Trpm3'

45130

Institutional Source

Beutler Lab

Gene Symbol

Trpm3

Ensembl Gene

ENSMUSG00000052387

Gene Name

transient receptor potential cation channel, subfamily M, member 3

Synonyms

B930001P07Rik, 6330504P12Rik, MLSN2, melastatin 2, LTRPC3

MMRRC Submission

038742-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

R0550 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22139119-22989884 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 22987812 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1547 (E1547G)

Ref Sequence

ENSEMBL: ENSMUSP00000074328 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037901] [ENSMUST00000074770] [ENSMUST00000087576] [ENSMUST00000099569]

AlphaFold

J9S314

Predicted Effect

probably benign
Transcript: ENSMUST00000037901

SMART Domains

Protein: ENSMUSP00000042184
Gene: ENSMUSG00000052387

Domain	Start	End	E-Value	Type
Blast:ANK	485	514	1e-6	BLAST
low complexity region	619	631	N/A	INTRINSIC
low complexity region	674	689	N/A	INTRINSIC
low complexity region	788	800	N/A	INTRINSIC
low complexity region	821	840	N/A	INTRINSIC
Pfam:Ion_trans	883	1136	1.7e-19	PFAM
Pfam:TRPM_tetra	1227	1282	1.5e-26	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000074770
AA Change: E1547G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000074328
Gene: ENSMUSG00000052387
AA Change: E1547G

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
Blast:ANK	487	516	5e-7	BLAST
low complexity region	611	623	N/A	INTRINSIC
low complexity region	666	681	N/A	INTRINSIC
low complexity region	780	792	N/A	INTRINSIC
low complexity region	813	832	N/A	INTRINSIC
transmembrane domain	874	896	N/A	INTRINSIC
Pfam:Ion_trans	908	1116	5.1e-14	PFAM
low complexity region	1378	1388	N/A	INTRINSIC
low complexity region	1433	1455	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000087576
AA Change: E1557G

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000084857
Gene: ENSMUSG00000052387
AA Change: E1557G

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
Blast:ANK	487	516	5e-7	BLAST
low complexity region	621	633	N/A	INTRINSIC
low complexity region	676	691	N/A	INTRINSIC
low complexity region	790	802	N/A	INTRINSIC
low complexity region	823	842	N/A	INTRINSIC
transmembrane domain	884	906	N/A	INTRINSIC
Pfam:Ion_trans	918	1126	5.1e-14	PFAM
low complexity region	1388	1398	N/A	INTRINSIC
low complexity region	1443	1465	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099569
AA Change: E1557G

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000097164
Gene: ENSMUSG00000052387
AA Change: E1557G

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
Blast:ANK	487	516	6e-7	BLAST
low complexity region	609	621	N/A	INTRINSIC
low complexity region	664	679	N/A	INTRINSIC
low complexity region	778	790	N/A	INTRINSIC
low complexity region	811	830	N/A	INTRINSIC
Pfam:Ion_trans	873	1138	3.2e-19	PFAM
Pfam:TRPM_tetra	1229	1284	4.4e-26	PFAM
low complexity region	1388	1398	N/A	INTRINSIC
low complexity region	1443	1465	N/A	INTRINSIC

Meta Mutation Damage Score

0.2496

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 97.0%
20x: 94.2%

Validation Efficiency

99% (76/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of transient receptor potential (TRP) channels. TRP channels are cation-selective channels important for cellular calcium signaling and homeostasis. The protein encoded by this gene mediates calcium entry, and this entry is potentiated by calcium store depletion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display impaired thermal and chemical nociception. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	T	11: 110,293,840	Y947N	probably damaging	Het
Acss3	C	A	10: 107,053,471	G163C	probably damaging	Het
Adcy10	A	G	1: 165,565,315	T1367A	probably benign	Het
Adcy2	A	T	13: 68,982,361	S136T	probably benign	Het
Ahdc1	G	A	4: 133,063,037	V530I	probably benign	Het
Aldh16a1	C	T	7: 45,146,229		probably null	Het
Ankrd36	T	C	11: 5,607,429		probably null	Het
Aqr	A	C	2: 114,132,976	N664K	probably damaging	Het
Atp6v1c1	T	C	15: 38,682,929		probably benign	Het
Atp8b2	C	T	3: 89,959,061		probably benign	Het
Bbx	T	C	16: 50,274,533		probably benign	Het
Bmper	T	A	9: 23,373,885	D243E	probably benign	Het
Casz1	GCCACCACCACCACCACCACCAC	GCCACCACCACCACCACCAC	4: 148,952,284		probably benign	Het
Catsperd	T	C	17: 56,663,427		probably null	Het
Ccdc92b	T	A	11: 74,629,945		probably null	Het
Cd2bp2	G	T	7: 127,193,824	T342K	probably damaging	Het
Clrn3	T	A	7: 135,528,425	I27F	possibly damaging	Het
Cnih3	TTGACGAG	T	1: 181,406,477		probably null	Het
Cntnap3	T	C	13: 64,762,000	T764A	possibly damaging	Het
Cttnbp2	T	G	6: 18,435,309	K183N	possibly damaging	Het
Cwc27	G	A	13: 104,804,949	P155L	probably damaging	Het
Dcaf10	T	C	4: 45,372,753	S389P	probably benign	Het
Ddx18	T	C	1: 121,555,375	K561E	probably benign	Het
Dkk3	A	G	7: 112,158,245	F51L	probably damaging	Het
Dnaic1	C	T	4: 41,596,274	R20*	probably null	Het
Dr1	G	A	5: 108,269,605	G6S	probably benign	Het
Dync2h1	A	T	9: 7,120,954		probably null	Het
Eif3l	A	G	15: 79,076,867	Y16C	probably damaging	Het
Epb41	A	G	4: 131,975,613	I464T	probably damaging	Het
Erc2	A	G	14: 28,271,651	K546E	possibly damaging	Het
F830045P16Rik	T	C	2: 129,463,509	D315G	probably damaging	Het
Fads6	A	G	11: 115,296,677	I64T	probably benign	Het
Fshr	T	C	17: 89,045,125	N107S	probably benign	Het
Gbp11	A	T	5: 105,343,750	N60K	probably benign	Het
Gm2a	C	T	11: 55,103,665	Q54*	probably null	Het
Hydin	A	G	8: 110,587,775	D4297G	probably benign	Het
Il6st	G	A	13: 112,475,114		probably null	Het
Inpp4b	T	A	8: 81,997,337	H499Q	probably benign	Het
Kif5c	A	G	2: 49,758,912	K956R	possibly damaging	Het
Krt74	G	A	15: 101,760,679		noncoding transcript	Het
Map3k9	A	T	12: 81,725,781	L649Q	probably damaging	Het
Mdn1	A	G	4: 32,730,479	D2871G	probably benign	Het
Mylk4	T	C	13: 32,716,666	T294A	probably benign	Het
Nbeal2	C	T	9: 110,642,158	V252I	probably benign	Het
Nectin3	A	G	16: 46,458,820	I265T	possibly damaging	Het
Olfr1065	A	T	2: 86,445,876	Y35*	probably null	Het
Olfr1109	G	T	2: 87,093,129	H89Q	probably benign	Het
Olfr1259	A	G	2: 89,943,389	I242T	probably damaging	Het
Olfr1447	A	T	19: 12,901,800		probably null	Het
Olfr181	A	G	16: 58,926,385	F62S	probably damaging	Het
Olfr554	G	A	7: 102,640,950	E235K	possibly damaging	Het
Olfr910	T	A	9: 38,539,380	C162S	probably damaging	Het
Opn1sw	A	T	6: 29,380,204	L71Q	probably damaging	Het
Pced1a	G	A	2: 130,419,633	P367S	probably benign	Het
Pkhd1	A	T	1: 20,347,223	M2568K	probably null	Het
Pla2r1	A	G	2: 60,425,350		probably null	Het
Plpp1	T	C	13: 112,834,985	I62T	probably benign	Het
Polr3g	G	A	13: 81,694,773	T41I	probably damaging	Het
Ptch2	T	C	4: 117,096,433		probably benign	Het
Sema4g	A	T	19: 44,997,665	H315L	probably benign	Het
Setd1b	G	T	5: 123,157,660	S1097I	unknown	Het
Sfxn4	A	G	19: 60,850,945		probably benign	Het
Sh3tc1	T	C	5: 35,699,784	E1237G	probably damaging	Het
Slc25a38	A	T	9: 120,123,643	N287I	probably benign	Het
Slc25a48	A	G	13: 56,448,998	T31A	probably benign	Het
Slc6a12	G	A	6: 121,356,918	V238I	probably damaging	Het
Slc8b1	A	G	5: 120,531,155		probably benign	Het
Slco4c1	A	C	1: 96,867,859	V158G	probably damaging	Het
Sptbn4	T	C	7: 27,364,378	T2208A	probably benign	Het
Srebf1	G	A	11: 60,201,676	T843I	probably benign	Het
Srl	A	G	16: 4,487,565	W101R	probably damaging	Het
St6galnac4	T	A	2: 32,594,019	C76*	probably null	Het
Tdrd3	C	A	14: 87,486,220	T290K	probably damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Ubn1	A	G	16: 5,062,620		probably null	Het
Usp10	T	A	8: 119,947,801	I456K	probably damaging	Het
Usp6nl	A	G	2: 6,400,323		probably benign	Het
Vit	T	A	17: 78,624,793	V443E	possibly damaging	Het
Whamm	G	A	7: 81,586,224	V392I	possibly damaging	Het
Zfhx4	A	G	3: 5,400,494	K1904R	probably damaging	Het
Zfp352	A	T	4: 90,224,690	T356S	probably damaging	Het

Other mutations in Trpm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Trpm3	APN	19	22987659	missense	probably benign	0.00
IGL00773:Trpm3	APN	19	22900159	missense	possibly damaging	0.92
IGL00852:Trpm3	APN	19	22987071	missense	possibly damaging	0.93
IGL01597:Trpm3	APN	19	22715246	missense	probably damaging	1.00
IGL01607:Trpm3	APN	19	22987127	missense	probably benign	0.01
IGL01818:Trpm3	APN	19	22914474	missense	probably damaging	1.00
IGL01890:Trpm3	APN	19	22711719	missense	probably damaging	0.98
IGL02016:Trpm3	APN	19	22902069	nonsense	probably null
IGL02324:Trpm3	APN	19	22698779	missense	probably benign	0.25
IGL02947:Trpm3	APN	19	22901119	missense	probably damaging	0.99
IGL03037:Trpm3	APN	19	22889412	missense	possibly damaging	0.85
IGL03128:Trpm3	APN	19	22914465	missense	probably damaging	1.00
IGL03335:Trpm3	APN	19	22926071	critical splice donor site	probably null
IGL03354:Trpm3	APN	19	22856718	missense	probably damaging	1.00
bit	UTSW	19	22987869	missense	probably benign	0.00
G1patch:Trpm3	UTSW	19	22926028	missense	probably damaging	1.00
P0041:Trpm3	UTSW	19	22897686	missense	probably benign	0.01
R0001:Trpm3	UTSW	19	22715331	missense	possibly damaging	0.70
R0007:Trpm3	UTSW	19	22987529	missense	probably benign	0.00
R0007:Trpm3	UTSW	19	22987529	missense	probably benign	0.00
R0009:Trpm3	UTSW	19	22914446	missense	probably damaging	1.00
R0009:Trpm3	UTSW	19	22914446	missense	probably damaging	1.00
R0142:Trpm3	UTSW	19	22987916	missense	probably damaging	0.98
R0194:Trpm3	UTSW	19	22715356	splice site	probably null
R0268:Trpm3	UTSW	19	22897521	critical splice donor site	probably null
R0299:Trpm3	UTSW	19	22986873	missense	possibly damaging	0.62
R0449:Trpm3	UTSW	19	22988054	missense	probably benign
R0481:Trpm3	UTSW	19	22901071	missense	possibly damaging	0.51
R0496:Trpm3	UTSW	19	22698778	missense	probably benign	0.00
R0499:Trpm3	UTSW	19	22986873	missense	possibly damaging	0.62
R0729:Trpm3	UTSW	19	22987789	missense	probably benign
R0883:Trpm3	UTSW	19	22978654	missense	probably damaging	1.00
R0926:Trpm3	UTSW	19	22988043	missense	probably benign	0.02
R1185:Trpm3	UTSW	19	22914417	splice site	probably benign
R1185:Trpm3	UTSW	19	22914417	splice site	probably benign
R1513:Trpm3	UTSW	19	22986872	missense	possibly damaging	0.96
R1521:Trpm3	UTSW	19	22901221	missense	probably damaging	1.00
R1522:Trpm3	UTSW	19	22978334	missense	probably benign	0.39
R1569:Trpm3	UTSW	19	22889445	critical splice donor site	probably null
R1598:Trpm3	UTSW	19	22733024	missense	possibly damaging	0.47
R1600:Trpm3	UTSW	19	22139155	missense	probably benign	0.00
R1616:Trpm3	UTSW	19	22982712	missense	probably damaging	1.00
R1619:Trpm3	UTSW	19	22711907	missense	probably damaging	0.99
R1923:Trpm3	UTSW	19	22885412	missense	probably damaging	1.00
R1985:Trpm3	UTSW	19	22926082	missense	possibly damaging	0.56
R2002:Trpm3	UTSW	19	22982583	missense	probably damaging	1.00
R2249:Trpm3	UTSW	19	22733034	missense	probably benign	0.15
R3719:Trpm3	UTSW	19	22986990	missense	possibly damaging	0.95
R3766:Trpm3	UTSW	19	22448377	missense	probably benign
R3774:Trpm3	UTSW	19	22978602	missense	possibly damaging	0.66
R3774:Trpm3	UTSW	19	22987975	missense	probably benign	0.03
R3776:Trpm3	UTSW	19	22978602	missense	possibly damaging	0.66
R3820:Trpm3	UTSW	19	22987449	missense	probably benign	0.00
R3899:Trpm3	UTSW	19	22901160	missense	possibly damaging	0.90
R4204:Trpm3	UTSW	19	22987564	missense	probably benign	0.00
R4238:Trpm3	UTSW	19	22978638	missense	probably damaging	1.00
R4301:Trpm3	UTSW	19	22987292	missense	probably benign	0.23
R4344:Trpm3	UTSW	19	22897697	missense	probably damaging	0.99
R4345:Trpm3	UTSW	19	22897697	missense	probably damaging	0.99
R4365:Trpm3	UTSW	19	22978330	missense	probably benign	0.00
R4510:Trpm3	UTSW	19	22988017	missense	probably benign	0.00
R4511:Trpm3	UTSW	19	22988017	missense	probably benign	0.00
R4565:Trpm3	UTSW	19	22987869	missense	probably benign	0.00
R4573:Trpm3	UTSW	19	22902142	missense	probably damaging	1.00
R4606:Trpm3	UTSW	19	22978624	missense	probably benign	0.26
R4677:Trpm3	UTSW	19	22987388	missense	possibly damaging	0.95
R4684:Trpm3	UTSW	19	22987781	missense	probably benign
R4713:Trpm3	UTSW	19	22889435	missense	possibly damaging	0.83
R4745:Trpm3	UTSW	19	22715295	missense	possibly damaging	0.67
R5015:Trpm3	UTSW	19	22711712	missense	probably damaging	1.00
R5030:Trpm3	UTSW	19	22698766	missense	probably benign	0.01
R5074:Trpm3	UTSW	19	22885349	missense	possibly damaging	0.65
R5089:Trpm3	UTSW	19	22766756	missense	probably damaging	0.97
R5100:Trpm3	UTSW	19	22918766	missense	probably damaging	0.99
R5108:Trpm3	UTSW	19	22904714	missense	probably benign	0.06
R5204:Trpm3	UTSW	19	22448341	nonsense	probably null
R5213:Trpm3	UTSW	19	22697454	nonsense	probably null
R5358:Trpm3	UTSW	19	22925968	missense	probably damaging	1.00
R5374:Trpm3	UTSW	19	22926184	nonsense	probably null
R5382:Trpm3	UTSW	19	22885341	splice site	probably null
R5509:Trpm3	UTSW	19	22987258	missense	probably damaging	0.99
R5558:Trpm3	UTSW	19	22978573	missense	probably damaging	1.00
R6154:Trpm3	UTSW	19	22987814	missense	probably damaging	1.00
R6250:Trpm3	UTSW	19	22910054	missense	probably benign	0.01
R6433:Trpm3	UTSW	19	22901305	missense	probably damaging	1.00
R6542:Trpm3	UTSW	19	22926113	missense	probably benign	0.04
R6630:Trpm3	UTSW	19	22987983	missense	probably benign	0.00
R6640:Trpm3	UTSW	19	22978582	missense	probably damaging	1.00
R6725:Trpm3	UTSW	19	22926028	missense	probably damaging	1.00
R7275:Trpm3	UTSW	19	22978684	missense	possibly damaging	0.71
R7371:Trpm3	UTSW	19	22902193	missense	probably benign	0.27
R7467:Trpm3	UTSW	19	22978334	missense	possibly damaging	0.82
R7488:Trpm3	UTSW	19	22978573	missense	probably damaging	1.00
R7495:Trpm3	UTSW	19	22897796	missense	probably benign	0.28
R7600:Trpm3	UTSW	19	22926094	missense	possibly damaging	0.68
R7710:Trpm3	UTSW	19	22918790	missense	probably damaging	0.97
R7877:Trpm3	UTSW	19	22904784	missense	probably benign	0.25
R8184:Trpm3	UTSW	19	22918696	missense	possibly damaging	0.46
R8234:Trpm3	UTSW	19	22715276	missense	possibly damaging	0.47
R8236:Trpm3	UTSW	19	22987408	missense	probably benign	0.00
R8443:Trpm3	UTSW	19	22698862	missense	possibly damaging	0.90
R8470:Trpm3	UTSW	19	22910137	missense	possibly damaging	0.91
R8784:Trpm3	UTSW	19	22918676	missense	probably benign	0.07
R8816:Trpm3	UTSW	19	22988216	missense	probably damaging	0.97
R8818:Trpm3	UTSW	19	22978588	missense	possibly damaging	0.81
R8875:Trpm3	UTSW	19	22910129	missense	probably damaging	1.00
R8931:Trpm3	UTSW	19	22766670	missense	probably damaging	1.00
R8969:Trpm3	UTSW	19	22925944	missense	probably damaging	0.98
R8987:Trpm3	UTSW	19	22918760	missense	probably damaging	1.00
R9300:Trpm3	UTSW	19	22978381	missense	possibly damaging	0.49
R9327:Trpm3	UTSW	19	22918640	missense	possibly damaging	0.56
R9354:Trpm3	UTSW	19	22448332	missense	probably benign
R9514:Trpm3	UTSW	19	22982676	missense	probably benign	0.42
R9545:Trpm3	UTSW	19	22901094	missense	probably benign	0.24
R9712:Trpm3	UTSW	19	22715352	missense	possibly damaging	0.55
R9721:Trpm3	UTSW	19	22889398	missense	probably benign	0.00
R9750:Trpm3	UTSW	19	22926131	missense	probably benign	0.00
Z1176:Trpm3	UTSW	19	22987490	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCAAGTAGTGCCTATGCAACGCTC -3'
(R):5'- TAGGATGGCTCAGCTCTGCTTCTC -3'

Sequencing Primer
(F):5'- ACCTCCCAGTAGGAGCATTG -3'
(R):5'- CTGCTTCTCGCTCAGGG -3'

Posted On

2013-06-11