Incidental Mutation 'R0550:Trpm3'
ID 45130
Institutional Source Beutler Lab
Gene Symbol Trpm3
Ensembl Gene ENSMUSG00000052387
Gene Name transient receptor potential cation channel, subfamily M, member 3
Synonyms 6330504P12Rik, LTRPC3, melastatin 2, B930001P07Rik, MLSN2
MMRRC Submission 038742-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R0550 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 22116410-22972774 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 22965176 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1547 (E1547G)
Ref Sequence ENSEMBL: ENSMUSP00000074328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037901] [ENSMUST00000074770] [ENSMUST00000087576] [ENSMUST00000099569]
AlphaFold J9S314
Predicted Effect probably benign
Transcript: ENSMUST00000037901
SMART Domains Protein: ENSMUSP00000042184
Gene: ENSMUSG00000052387

DomainStartEndE-ValueType
Blast:ANK 485 514 1e-6 BLAST
low complexity region 619 631 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 788 800 N/A INTRINSIC
low complexity region 821 840 N/A INTRINSIC
Pfam:Ion_trans 883 1136 1.7e-19 PFAM
Pfam:TRPM_tetra 1227 1282 1.5e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000074770
AA Change: E1547G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074328
Gene: ENSMUSG00000052387
AA Change: E1547G

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
Blast:ANK 487 516 5e-7 BLAST
low complexity region 611 623 N/A INTRINSIC
low complexity region 666 681 N/A INTRINSIC
low complexity region 780 792 N/A INTRINSIC
low complexity region 813 832 N/A INTRINSIC
transmembrane domain 874 896 N/A INTRINSIC
Pfam:Ion_trans 908 1116 5.1e-14 PFAM
low complexity region 1378 1388 N/A INTRINSIC
low complexity region 1433 1455 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000087576
AA Change: E1557G

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084857
Gene: ENSMUSG00000052387
AA Change: E1557G

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
Blast:ANK 487 516 5e-7 BLAST
low complexity region 621 633 N/A INTRINSIC
low complexity region 676 691 N/A INTRINSIC
low complexity region 790 802 N/A INTRINSIC
low complexity region 823 842 N/A INTRINSIC
transmembrane domain 884 906 N/A INTRINSIC
Pfam:Ion_trans 918 1126 5.1e-14 PFAM
low complexity region 1388 1398 N/A INTRINSIC
low complexity region 1443 1465 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099569
AA Change: E1557G

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097164
Gene: ENSMUSG00000052387
AA Change: E1557G

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
Blast:ANK 487 516 6e-7 BLAST
low complexity region 609 621 N/A INTRINSIC
low complexity region 664 679 N/A INTRINSIC
low complexity region 778 790 N/A INTRINSIC
low complexity region 811 830 N/A INTRINSIC
Pfam:Ion_trans 873 1138 3.2e-19 PFAM
Pfam:TRPM_tetra 1229 1284 4.4e-26 PFAM
low complexity region 1388 1398 N/A INTRINSIC
low complexity region 1443 1465 N/A INTRINSIC
Meta Mutation Damage Score 0.2496 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of transient receptor potential (TRP) channels. TRP channels are cation-selective channels important for cellular calcium signaling and homeostasis. The protein encoded by this gene mediates calcium entry, and this entry is potentiated by calcium store depletion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display impaired thermal and chemical nociception. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,184,666 (GRCm39) Y947N probably damaging Het
Acss3 C A 10: 106,889,332 (GRCm39) G163C probably damaging Het
Adcy10 A G 1: 165,392,884 (GRCm39) T1367A probably benign Het
Adcy2 A T 13: 69,130,480 (GRCm39) S136T probably benign Het
Ahdc1 G A 4: 132,790,348 (GRCm39) V530I probably benign Het
Aldh16a1 C T 7: 44,795,653 (GRCm39) probably null Het
Ankrd36 T C 11: 5,557,429 (GRCm39) probably null Het
Aqr A C 2: 113,963,457 (GRCm39) N664K probably damaging Het
Atp6v1c1 T C 15: 38,683,173 (GRCm39) probably benign Het
Atp8b2 C T 3: 89,866,368 (GRCm39) probably benign Het
Bbx T C 16: 50,094,896 (GRCm39) probably benign Het
Bmper T A 9: 23,285,181 (GRCm39) D243E probably benign Het
Casz1 GCCACCACCACCACCACCACCAC GCCACCACCACCACCACCAC 4: 149,036,741 (GRCm39) probably benign Het
Catsperd T C 17: 56,970,427 (GRCm39) probably null Het
Ccdc92b T A 11: 74,520,771 (GRCm39) probably null Het
Cd2bp2 G T 7: 126,792,996 (GRCm39) T342K probably damaging Het
Clrn3 T A 7: 135,130,154 (GRCm39) I27F possibly damaging Het
Cnih3 TTGACGAG T 1: 181,234,042 (GRCm39) probably null Het
Cntnap3 T C 13: 64,909,814 (GRCm39) T764A possibly damaging Het
Cttnbp2 T G 6: 18,435,308 (GRCm39) K183N possibly damaging Het
Cwc27 G A 13: 104,941,457 (GRCm39) P155L probably damaging Het
Dcaf10 T C 4: 45,372,753 (GRCm39) S389P probably benign Het
Ddx18 T C 1: 121,483,104 (GRCm39) K561E probably benign Het
Dkk3 A G 7: 111,757,452 (GRCm39) F51L probably damaging Het
Dnai1 C T 4: 41,596,274 (GRCm39) R20* probably null Het
Dr1 G A 5: 108,417,471 (GRCm39) G6S probably benign Het
Dync2h1 A T 9: 7,120,954 (GRCm39) probably null Het
Eif3l A G 15: 78,961,067 (GRCm39) Y16C probably damaging Het
Epb41 A G 4: 131,702,924 (GRCm39) I464T probably damaging Het
Erc2 A G 14: 27,993,608 (GRCm39) K546E possibly damaging Het
F830045P16Rik T C 2: 129,305,429 (GRCm39) D315G probably damaging Het
Fads6 A G 11: 115,187,503 (GRCm39) I64T probably benign Het
Fshr T C 17: 89,352,553 (GRCm39) N107S probably benign Het
Gbp11 A T 5: 105,491,616 (GRCm39) N60K probably benign Het
Gm2a C T 11: 54,994,491 (GRCm39) Q54* probably null Het
Hydin A G 8: 111,314,407 (GRCm39) D4297G probably benign Het
Il6st G A 13: 112,611,648 (GRCm39) probably null Het
Inpp4b T A 8: 82,723,966 (GRCm39) H499Q probably benign Het
Kif5c A G 2: 49,648,924 (GRCm39) K956R possibly damaging Het
Krt74 G A 15: 101,669,114 (GRCm39) noncoding transcript Het
Map3k9 A T 12: 81,772,555 (GRCm39) L649Q probably damaging Het
Mdn1 A G 4: 32,730,479 (GRCm39) D2871G probably benign Het
Mylk4 T C 13: 32,900,649 (GRCm39) T294A probably benign Het
Nbeal2 C T 9: 110,471,226 (GRCm39) V252I probably benign Het
Nectin3 A G 16: 46,279,183 (GRCm39) I265T possibly damaging Het
Opn1sw A T 6: 29,380,203 (GRCm39) L71Q probably damaging Het
Or4c12 A G 2: 89,773,733 (GRCm39) I242T probably damaging Het
Or52m1 G A 7: 102,290,157 (GRCm39) E235K possibly damaging Het
Or5aq6 G T 2: 86,923,473 (GRCm39) H89Q probably benign Het
Or5b97 A T 19: 12,879,164 (GRCm39) probably null Het
Or5k17 A G 16: 58,746,748 (GRCm39) F62S probably damaging Het
Or8b46 T A 9: 38,450,676 (GRCm39) C162S probably damaging Het
Or8k27 A T 2: 86,276,220 (GRCm39) Y35* probably null Het
Pced1a G A 2: 130,261,553 (GRCm39) P367S probably benign Het
Pkhd1 A T 1: 20,417,447 (GRCm39) M2568K probably null Het
Pla2r1 A G 2: 60,255,694 (GRCm39) probably null Het
Plpp1 T C 13: 112,971,519 (GRCm39) I62T probably benign Het
Polr3g G A 13: 81,842,892 (GRCm39) T41I probably damaging Het
Ptch2 T C 4: 116,953,630 (GRCm39) probably benign Het
Sema4g A T 19: 44,986,104 (GRCm39) H315L probably benign Het
Setd1b G T 5: 123,295,723 (GRCm39) S1097I unknown Het
Sfxn4 A G 19: 60,839,383 (GRCm39) probably benign Het
Sh3tc1 T C 5: 35,857,128 (GRCm39) E1237G probably damaging Het
Slc25a38 A T 9: 119,952,709 (GRCm39) N287I probably benign Het
Slc25a48 A G 13: 56,596,811 (GRCm39) T31A probably benign Het
Slc6a12 G A 6: 121,333,877 (GRCm39) V238I probably damaging Het
Slc8b1 A G 5: 120,669,220 (GRCm39) probably benign Het
Slco4c1 A C 1: 96,795,584 (GRCm39) V158G probably damaging Het
Sptbn4 T C 7: 27,063,803 (GRCm39) T2208A probably benign Het
Srebf1 G A 11: 60,092,502 (GRCm39) T843I probably benign Het
Srl A G 16: 4,305,429 (GRCm39) W101R probably damaging Het
St6galnac4 T A 2: 32,484,031 (GRCm39) C76* probably null Het
Tdrd3 C A 14: 87,723,656 (GRCm39) T290K probably damaging Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Ubn1 A G 16: 4,880,484 (GRCm39) probably null Het
Usp10 T A 8: 120,674,540 (GRCm39) I456K probably damaging Het
Usp6nl A G 2: 6,405,134 (GRCm39) probably benign Het
Vit T A 17: 78,932,222 (GRCm39) V443E possibly damaging Het
Whamm G A 7: 81,235,972 (GRCm39) V392I possibly damaging Het
Zfhx4 A G 3: 5,465,554 (GRCm39) K1904R probably damaging Het
Zfp352 A T 4: 90,112,927 (GRCm39) T356S probably damaging Het
Other mutations in Trpm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Trpm3 APN 19 22,965,023 (GRCm39) missense probably benign 0.00
IGL00773:Trpm3 APN 19 22,877,523 (GRCm39) missense possibly damaging 0.92
IGL00852:Trpm3 APN 19 22,964,435 (GRCm39) missense possibly damaging 0.93
IGL01597:Trpm3 APN 19 22,692,610 (GRCm39) missense probably damaging 1.00
IGL01607:Trpm3 APN 19 22,964,491 (GRCm39) missense probably benign 0.01
IGL01818:Trpm3 APN 19 22,891,838 (GRCm39) missense probably damaging 1.00
IGL01890:Trpm3 APN 19 22,689,083 (GRCm39) missense probably damaging 0.98
IGL02016:Trpm3 APN 19 22,879,433 (GRCm39) nonsense probably null
IGL02324:Trpm3 APN 19 22,676,143 (GRCm39) missense probably benign 0.25
IGL02947:Trpm3 APN 19 22,878,483 (GRCm39) missense probably damaging 0.99
IGL03037:Trpm3 APN 19 22,866,776 (GRCm39) missense possibly damaging 0.85
IGL03128:Trpm3 APN 19 22,891,829 (GRCm39) missense probably damaging 1.00
IGL03335:Trpm3 APN 19 22,903,435 (GRCm39) critical splice donor site probably null
IGL03354:Trpm3 APN 19 22,834,082 (GRCm39) missense probably damaging 1.00
bit UTSW 19 22,965,233 (GRCm39) missense probably benign 0.00
G1patch:Trpm3 UTSW 19 22,903,392 (GRCm39) missense probably damaging 1.00
P0041:Trpm3 UTSW 19 22,875,050 (GRCm39) missense probably benign 0.01
R0001:Trpm3 UTSW 19 22,692,695 (GRCm39) missense possibly damaging 0.70
R0007:Trpm3 UTSW 19 22,964,893 (GRCm39) missense probably benign 0.00
R0007:Trpm3 UTSW 19 22,964,893 (GRCm39) missense probably benign 0.00
R0009:Trpm3 UTSW 19 22,891,810 (GRCm39) missense probably damaging 1.00
R0009:Trpm3 UTSW 19 22,891,810 (GRCm39) missense probably damaging 1.00
R0142:Trpm3 UTSW 19 22,965,280 (GRCm39) missense probably damaging 0.98
R0194:Trpm3 UTSW 19 22,692,720 (GRCm39) splice site probably null
R0268:Trpm3 UTSW 19 22,874,885 (GRCm39) critical splice donor site probably null
R0299:Trpm3 UTSW 19 22,964,237 (GRCm39) missense possibly damaging 0.62
R0449:Trpm3 UTSW 19 22,965,418 (GRCm39) missense probably benign
R0481:Trpm3 UTSW 19 22,878,435 (GRCm39) missense possibly damaging 0.51
R0496:Trpm3 UTSW 19 22,676,142 (GRCm39) missense probably benign 0.00
R0499:Trpm3 UTSW 19 22,964,237 (GRCm39) missense possibly damaging 0.62
R0729:Trpm3 UTSW 19 22,965,153 (GRCm39) missense probably benign
R0883:Trpm3 UTSW 19 22,956,018 (GRCm39) missense probably damaging 1.00
R0926:Trpm3 UTSW 19 22,965,407 (GRCm39) missense probably benign 0.02
R1185:Trpm3 UTSW 19 22,891,781 (GRCm39) splice site probably benign
R1185:Trpm3 UTSW 19 22,891,781 (GRCm39) splice site probably benign
R1513:Trpm3 UTSW 19 22,964,236 (GRCm39) missense possibly damaging 0.96
R1521:Trpm3 UTSW 19 22,878,585 (GRCm39) missense probably damaging 1.00
R1522:Trpm3 UTSW 19 22,955,698 (GRCm39) missense probably benign 0.39
R1569:Trpm3 UTSW 19 22,866,809 (GRCm39) critical splice donor site probably null
R1598:Trpm3 UTSW 19 22,710,388 (GRCm39) missense possibly damaging 0.47
R1600:Trpm3 UTSW 19 22,116,519 (GRCm39) missense probably benign 0.00
R1616:Trpm3 UTSW 19 22,960,076 (GRCm39) missense probably damaging 1.00
R1619:Trpm3 UTSW 19 22,689,271 (GRCm39) missense probably damaging 0.99
R1923:Trpm3 UTSW 19 22,862,776 (GRCm39) missense probably damaging 1.00
R1985:Trpm3 UTSW 19 22,903,446 (GRCm39) missense possibly damaging 0.56
R2002:Trpm3 UTSW 19 22,959,947 (GRCm39) missense probably damaging 1.00
R2249:Trpm3 UTSW 19 22,710,398 (GRCm39) missense probably benign 0.15
R3719:Trpm3 UTSW 19 22,964,354 (GRCm39) missense possibly damaging 0.95
R3766:Trpm3 UTSW 19 22,425,741 (GRCm39) missense probably benign
R3774:Trpm3 UTSW 19 22,965,339 (GRCm39) missense probably benign 0.03
R3774:Trpm3 UTSW 19 22,955,966 (GRCm39) missense possibly damaging 0.66
R3776:Trpm3 UTSW 19 22,955,966 (GRCm39) missense possibly damaging 0.66
R3820:Trpm3 UTSW 19 22,964,813 (GRCm39) missense probably benign 0.00
R3899:Trpm3 UTSW 19 22,878,524 (GRCm39) missense possibly damaging 0.90
R4204:Trpm3 UTSW 19 22,964,928 (GRCm39) missense probably benign 0.00
R4238:Trpm3 UTSW 19 22,956,002 (GRCm39) missense probably damaging 1.00
R4301:Trpm3 UTSW 19 22,964,656 (GRCm39) missense probably benign 0.23
R4344:Trpm3 UTSW 19 22,875,061 (GRCm39) missense probably damaging 0.99
R4345:Trpm3 UTSW 19 22,875,061 (GRCm39) missense probably damaging 0.99
R4365:Trpm3 UTSW 19 22,955,694 (GRCm39) missense probably benign 0.00
R4510:Trpm3 UTSW 19 22,965,381 (GRCm39) missense probably benign 0.00
R4511:Trpm3 UTSW 19 22,965,381 (GRCm39) missense probably benign 0.00
R4565:Trpm3 UTSW 19 22,965,233 (GRCm39) missense probably benign 0.00
R4573:Trpm3 UTSW 19 22,879,506 (GRCm39) missense probably damaging 1.00
R4606:Trpm3 UTSW 19 22,955,988 (GRCm39) missense probably benign 0.26
R4677:Trpm3 UTSW 19 22,964,752 (GRCm39) missense possibly damaging 0.95
R4684:Trpm3 UTSW 19 22,965,145 (GRCm39) missense probably benign
R4713:Trpm3 UTSW 19 22,866,799 (GRCm39) missense possibly damaging 0.83
R4745:Trpm3 UTSW 19 22,692,659 (GRCm39) missense possibly damaging 0.67
R5015:Trpm3 UTSW 19 22,689,076 (GRCm39) missense probably damaging 1.00
R5030:Trpm3 UTSW 19 22,676,130 (GRCm39) missense probably benign 0.01
R5074:Trpm3 UTSW 19 22,862,713 (GRCm39) missense possibly damaging 0.65
R5089:Trpm3 UTSW 19 22,744,120 (GRCm39) missense probably damaging 0.97
R5100:Trpm3 UTSW 19 22,896,130 (GRCm39) missense probably damaging 0.99
R5108:Trpm3 UTSW 19 22,882,078 (GRCm39) missense probably benign 0.06
R5204:Trpm3 UTSW 19 22,425,705 (GRCm39) nonsense probably null
R5213:Trpm3 UTSW 19 22,674,818 (GRCm39) nonsense probably null
R5358:Trpm3 UTSW 19 22,903,332 (GRCm39) missense probably damaging 1.00
R5374:Trpm3 UTSW 19 22,903,548 (GRCm39) nonsense probably null
R5382:Trpm3 UTSW 19 22,862,705 (GRCm39) splice site probably null
R5509:Trpm3 UTSW 19 22,964,622 (GRCm39) missense probably damaging 0.99
R5558:Trpm3 UTSW 19 22,955,937 (GRCm39) missense probably damaging 1.00
R6154:Trpm3 UTSW 19 22,965,178 (GRCm39) missense probably damaging 1.00
R6250:Trpm3 UTSW 19 22,887,418 (GRCm39) missense probably benign 0.01
R6433:Trpm3 UTSW 19 22,878,669 (GRCm39) missense probably damaging 1.00
R6542:Trpm3 UTSW 19 22,903,477 (GRCm39) missense probably benign 0.04
R6630:Trpm3 UTSW 19 22,965,347 (GRCm39) missense probably benign 0.00
R6640:Trpm3 UTSW 19 22,955,946 (GRCm39) missense probably damaging 1.00
R6725:Trpm3 UTSW 19 22,903,392 (GRCm39) missense probably damaging 1.00
R7275:Trpm3 UTSW 19 22,956,048 (GRCm39) missense possibly damaging 0.71
R7371:Trpm3 UTSW 19 22,879,557 (GRCm39) missense probably benign 0.27
R7467:Trpm3 UTSW 19 22,955,698 (GRCm39) missense possibly damaging 0.82
R7488:Trpm3 UTSW 19 22,955,937 (GRCm39) missense probably damaging 1.00
R7495:Trpm3 UTSW 19 22,875,160 (GRCm39) missense probably benign 0.28
R7600:Trpm3 UTSW 19 22,903,458 (GRCm39) missense possibly damaging 0.68
R7710:Trpm3 UTSW 19 22,896,154 (GRCm39) missense probably damaging 0.97
R7877:Trpm3 UTSW 19 22,882,148 (GRCm39) missense probably benign 0.25
R8184:Trpm3 UTSW 19 22,896,060 (GRCm39) missense possibly damaging 0.46
R8234:Trpm3 UTSW 19 22,692,640 (GRCm39) missense possibly damaging 0.47
R8236:Trpm3 UTSW 19 22,964,772 (GRCm39) missense probably benign 0.00
R8443:Trpm3 UTSW 19 22,676,226 (GRCm39) missense possibly damaging 0.90
R8470:Trpm3 UTSW 19 22,887,501 (GRCm39) missense possibly damaging 0.91
R8784:Trpm3 UTSW 19 22,896,040 (GRCm39) missense probably benign 0.07
R8816:Trpm3 UTSW 19 22,965,580 (GRCm39) missense probably damaging 0.97
R8818:Trpm3 UTSW 19 22,955,952 (GRCm39) missense possibly damaging 0.81
R8875:Trpm3 UTSW 19 22,887,493 (GRCm39) missense probably damaging 1.00
R8931:Trpm3 UTSW 19 22,744,034 (GRCm39) missense probably damaging 1.00
R8969:Trpm3 UTSW 19 22,903,308 (GRCm39) missense probably damaging 0.98
R8987:Trpm3 UTSW 19 22,896,124 (GRCm39) missense probably damaging 1.00
R9300:Trpm3 UTSW 19 22,955,745 (GRCm39) missense possibly damaging 0.49
R9327:Trpm3 UTSW 19 22,896,004 (GRCm39) missense possibly damaging 0.56
R9354:Trpm3 UTSW 19 22,425,696 (GRCm39) missense probably benign
R9514:Trpm3 UTSW 19 22,960,040 (GRCm39) missense probably benign 0.42
R9545:Trpm3 UTSW 19 22,878,458 (GRCm39) missense probably benign 0.24
R9712:Trpm3 UTSW 19 22,692,716 (GRCm39) missense possibly damaging 0.55
R9721:Trpm3 UTSW 19 22,866,762 (GRCm39) missense probably benign 0.00
R9750:Trpm3 UTSW 19 22,903,495 (GRCm39) missense probably benign 0.00
Z1176:Trpm3 UTSW 19 22,964,854 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAAGTAGTGCCTATGCAACGCTC -3'
(R):5'- TAGGATGGCTCAGCTCTGCTTCTC -3'

Sequencing Primer
(F):5'- ACCTCCCAGTAGGAGCATTG -3'
(R):5'- CTGCTTCTCGCTCAGGG -3'
Posted On 2013-06-11