Incidental Mutation 'R5718:Pfn3'
ID451306
Institutional Source Beutler Lab
Gene Symbol Pfn3
Ensembl Gene ENSMUSG00000044444
Gene Nameprofilin 3
Synonyms
MMRRC Submission 043338-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5718 (G1)
Quality Score144
Status Not validated
Chromosome13
Chromosomal Location55414688-55415232 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55415040 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 43 (I43V)
Ref Sequence ENSEMBL: ENSMUSP00000054053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021948] [ENSMUST00000054146] [ENSMUST00000057167] [ENSMUST00000170921] [ENSMUST00000224925] [ENSMUST00000225259]
Predicted Effect probably benign
Transcript: ENSMUST00000021948
SMART Domains Protein: ENSMUSP00000021948
Gene: ENSMUSG00000021492

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
FN2 40 88 4.3e-24 SMART
EGF 97 131 4.22e-4 SMART
FN1 135 175 2.4e-13 SMART
EGF 177 210 3.94e-4 SMART
KR 215 297 6.88e-27 SMART
low complexity region 302 320 N/A INTRINSIC
Tryp_SPc 354 591 7.74e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054146
AA Change: I43V

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000054053
Gene: ENSMUSG00000044444
AA Change: I43V

DomainStartEndE-ValueType
Pfam:Profilin 3 132 7.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057167
SMART Domains Protein: ENSMUSP00000059138
Gene: ENSMUSG00000021490

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 113 256 7.4e-28 PFAM
Pfam:Na_Pi_cotrans 359 549 2.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170921
SMART Domains Protein: ENSMUSP00000125771
Gene: ENSMUSG00000021492

DomainStartEndE-ValueType
Tryp_SPc 2 137 3.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224043
Predicted Effect probably benign
Transcript: ENSMUST00000224925
Predicted Effect probably benign
Transcript: ENSMUST00000225259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225538
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the profilin family of proteins. This protein binds to actin and affects the structure of the cytoskeleton. It also may be involved in spermatogenesis. It is a single exon gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 T C 8: 27,113,486 probably null Het
Ahctf1 G T 1: 179,769,339 H81N possibly damaging Het
Alyref2 T C 1: 171,504,110 S152P possibly damaging Het
Arhgef7 C T 8: 11,785,774 T20I probably damaging Het
Armc3 T G 2: 19,303,799 Y759* probably null Het
Atg5 A G 10: 44,362,987 S255G probably benign Het
Atp11b A G 3: 35,837,516 I1026V probably benign Het
Atp1a2 C A 1: 172,279,442 K770N probably damaging Het
Bptf G T 11: 107,111,434 A284E probably damaging Het
Celsr2 A G 3: 108,393,358 S815P probably benign Het
Chrna5 A G 9: 54,998,105 H67R probably benign Het
Cic A G 7: 25,272,778 I645V probably benign Het
Clpx A T 9: 65,299,964 Q48L probably benign Het
Crhr2 G A 6: 55,092,100 Q397* probably null Het
Cyp11a1 G A 9: 58,018,225 V48I probably benign Het
Dchs1 C T 7: 105,755,748 R2529H probably benign Het
Dnah7c A T 1: 46,748,666 H3293L possibly damaging Het
Dock6 G T 9: 21,824,493 D986E probably benign Het
Efcab6 T A 15: 83,904,238 N952Y probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epg5 G A 18: 77,986,403 C1327Y probably damaging Het
Fbxw18 T C 9: 109,691,568 E241G probably benign Het
Fsd1 T G 17: 55,990,542 probably benign Het
Gcnt3 A G 9: 70,034,270 S339P probably benign Het
Gldc T A 19: 30,110,772 K829* probably null Het
Gli3 G A 13: 15,478,165 probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Hmcn1 A T 1: 150,609,666 I4395N probably damaging Het
Hmcn1 A T 1: 150,690,600 C2217* probably null Het
Hmgxb3 A G 18: 61,140,837 M861T probably benign Het
Ift172 A G 5: 31,255,277 S1545P possibly damaging Het
Jak3 C A 8: 71,684,354 L725M probably damaging Het
Lrig2 A T 3: 104,468,615 C90* probably null Het
Mcm7 C T 5: 138,164,819 R357H possibly damaging Het
Mcoln2 T C 3: 146,181,826 S333P probably damaging Het
Mrpl22 A T 11: 58,177,283 I136L probably benign Het
Ncam2 A T 16: 81,589,814 probably null Het
Ncdn G A 4: 126,749,950 Q360* probably null Het
Nsun2 A G 13: 69,623,284 K338E probably benign Het
Obscn T C 11: 59,036,808 T6105A probably damaging Het
Olfr171 G A 16: 19,624,389 S237F probably benign Het
Olfr957 A T 9: 39,511,042 L226H probably damaging Het
Pcnx4 T A 12: 72,567,194 F638I possibly damaging Het
Pigm C A 1: 172,377,445 probably null Het
Pkhd1l1 T A 15: 44,545,417 S2433R probably damaging Het
Pomt1 C A 2: 32,248,692 A440D possibly damaging Het
Ptprj T C 2: 90,458,269 D691G probably benign Het
Qrich1 T A 9: 108,528,823 S72T probably damaging Het
Ralgapa2 T A 2: 146,453,406 probably null Het
Rarg A C 15: 102,241,067 S156A probably damaging Het
Rasl11a A G 5: 146,847,144 K133R probably benign Het
Rcor1 A G 12: 111,101,635 D158G probably benign Het
Rpn2 C T 2: 157,321,827 T613M probably damaging Het
Sipa1l2 T A 8: 125,491,248 H450L probably damaging Het
Slc25a21 T C 12: 56,718,156 I263V probably benign Het
Slc25a32 A T 15: 39,097,562 V242E probably benign Het
Slc5a5 T A 8: 70,887,755 T484S probably benign Het
Tdrd3 T C 14: 87,506,440 V608A probably benign Het
Thnsl1 C A 2: 21,212,000 H188Q possibly damaging Het
Tshz1 A T 18: 84,014,524 H586Q probably damaging Het
Vmn2r27 C T 6: 124,192,144 A676T possibly damaging Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Xbp1 T A 11: 5,521,903 F10I probably benign Het
Zbtb1 G A 12: 76,386,924 M561I probably benign Het
Zfp708 T C 13: 67,070,458 K446E probably benign Het
Other mutations in Pfn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Pfn3 APN 13 55414828 missense possibly damaging 0.86
IGL02126:Pfn3 APN 13 55414886 missense possibly damaging 0.92
R1490:Pfn3 UTSW 13 55414919 missense probably damaging 1.00
R7765:Pfn3 UTSW 13 55415087 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGCACTGTCTTATTGAGGATGCC -3'
(R):5'- CCCCTAATGCAAGCACAAGTTG -3'

Sequencing Primer
(F):5'- AGGATGCCTCCATGCACG -3'
(R):5'- CACAAGTTGCTGGGACTGACTG -3'
Posted On2017-01-03