Incidental Mutation 'R5718:Or2aj6'
ID 451315
Institutional Source Beutler Lab
Gene Symbol Or2aj6
Ensembl Gene ENSMUSG00000060480
Gene Name olfactory receptor family 2 subfamily AJ member 6
Synonyms GA_x54KRFPKG5P-16071018-16070077, MOR273-5, MOR273-1, Olfr171
MMRRC Submission 043338-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R5718 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 19442907-19443851 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 19443139 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Phenylalanine at position 237 (S237F)
Ref Sequence ENSEMBL: ENSMUSP00000145692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079891] [ENSMUST00000205467]
AlphaFold G5E8J1
Predicted Effect probably benign
Transcript: ENSMUST00000079891
AA Change: S238F

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000078814
Gene: ENSMUSG00000060480
AA Change: S238F

DomainStartEndE-ValueType
Pfam:7tm_4 29 309 2.6e-43 PFAM
Pfam:7TM_GPCR_Srsx 36 261 8.6e-6 PFAM
Pfam:7tm_1 42 291 3.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205467
AA Change: S237F

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 T C 8: 27,603,514 (GRCm39) probably null Het
Ahctf1 G T 1: 179,596,904 (GRCm39) H81N possibly damaging Het
Alyref2 T C 1: 171,331,678 (GRCm39) S152P possibly damaging Het
Arhgef7 C T 8: 11,835,774 (GRCm39) T20I probably damaging Het
Armc3 T G 2: 19,308,610 (GRCm39) Y759* probably null Het
Atg5 A G 10: 44,238,983 (GRCm39) S255G probably benign Het
Atp11b A G 3: 35,891,665 (GRCm39) I1026V probably benign Het
Atp1a2 C A 1: 172,107,009 (GRCm39) K770N probably damaging Het
Bptf G T 11: 107,002,260 (GRCm39) A284E probably damaging Het
Celsr2 A G 3: 108,300,674 (GRCm39) S815P probably benign Het
Chrna5 A G 9: 54,905,389 (GRCm39) H67R probably benign Het
Cic A G 7: 24,972,203 (GRCm39) I645V probably benign Het
Clpx A T 9: 65,207,246 (GRCm39) Q48L probably benign Het
Crhr2 G A 6: 55,069,085 (GRCm39) Q397* probably null Het
Cyp11a1 G A 9: 57,925,508 (GRCm39) V48I probably benign Het
Dchs1 C T 7: 105,404,955 (GRCm39) R2529H probably benign Het
Dnah7c A T 1: 46,787,826 (GRCm39) H3293L possibly damaging Het
Dock6 G T 9: 21,735,789 (GRCm39) D986E probably benign Het
Efcab6 T A 15: 83,788,439 (GRCm39) N952Y probably damaging Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Epg5 G A 18: 78,029,618 (GRCm39) C1327Y probably damaging Het
Fbxw18 T C 9: 109,520,636 (GRCm39) E241G probably benign Het
Fsd1 T G 17: 56,297,542 (GRCm39) probably benign Het
Gcnt3 A G 9: 69,941,552 (GRCm39) S339P probably benign Het
Gldc T A 19: 30,088,172 (GRCm39) K829* probably null Het
Gli3 G A 13: 15,652,750 (GRCm39) probably null Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Greb1l G A 18: 10,542,427 (GRCm39) E1341K probably damaging Het
Hmcn1 A T 1: 150,566,351 (GRCm39) C2217* probably null Het
Hmcn1 A T 1: 150,485,417 (GRCm39) I4395N probably damaging Het
Hmgxb3 A G 18: 61,273,909 (GRCm39) M861T probably benign Het
Ift172 A G 5: 31,412,621 (GRCm39) S1545P possibly damaging Het
Jak3 C A 8: 72,136,998 (GRCm39) L725M probably damaging Het
Lrig2 A T 3: 104,375,931 (GRCm39) C90* probably null Het
Mcm7 C T 5: 138,163,081 (GRCm39) R357H possibly damaging Het
Mcoln2 T C 3: 145,887,581 (GRCm39) S333P probably damaging Het
Mrpl22 A T 11: 58,068,109 (GRCm39) I136L probably benign Het
Ncam2 A T 16: 81,386,702 (GRCm39) probably null Het
Ncdn G A 4: 126,643,743 (GRCm39) Q360* probably null Het
Nsun2 A G 13: 69,771,403 (GRCm39) K338E probably benign Het
Obscn T C 11: 58,927,634 (GRCm39) T6105A probably damaging Het
Or8g36 A T 9: 39,422,338 (GRCm39) L226H probably damaging Het
Pcnx4 T A 12: 72,613,968 (GRCm39) F638I possibly damaging Het
Pfn3 T C 13: 55,562,853 (GRCm39) I43V probably benign Het
Pigm C A 1: 172,205,012 (GRCm39) probably null Het
Pkhd1l1 T A 15: 44,408,813 (GRCm39) S2433R probably damaging Het
Pomt1 C A 2: 32,138,704 (GRCm39) A440D possibly damaging Het
Ptprj T C 2: 90,288,613 (GRCm39) D691G probably benign Het
Qrich1 T A 9: 108,406,022 (GRCm39) S72T probably damaging Het
Ralgapa2 T A 2: 146,295,326 (GRCm39) probably null Het
Rarg A C 15: 102,149,502 (GRCm39) S156A probably damaging Het
Rasl11a A G 5: 146,783,954 (GRCm39) K133R probably benign Het
Rcor1 A G 12: 111,068,069 (GRCm39) D158G probably benign Het
Rpn2 C T 2: 157,163,747 (GRCm39) T613M probably damaging Het
Sipa1l2 T A 8: 126,217,987 (GRCm39) H450L probably damaging Het
Slc25a21 T C 12: 56,764,941 (GRCm39) I263V probably benign Het
Slc25a32 A T 15: 38,960,957 (GRCm39) V242E probably benign Het
Slc5a5 T A 8: 71,340,399 (GRCm39) T484S probably benign Het
Tdrd3 T C 14: 87,743,876 (GRCm39) V608A probably benign Het
Thnsl1 C A 2: 21,216,811 (GRCm39) H188Q possibly damaging Het
Tshz1 A T 18: 84,032,649 (GRCm39) H586Q probably damaging Het
Vmn2r27 C T 6: 124,169,103 (GRCm39) A676T possibly damaging Het
Wasf1 G A 10: 40,802,570 (GRCm39) R75Q probably damaging Het
Xbp1 T A 11: 5,471,903 (GRCm39) F10I probably benign Het
Zbtb1 G A 12: 76,433,698 (GRCm39) M561I probably benign Het
Zfp708 T C 13: 67,218,522 (GRCm39) K446E probably benign Het
Other mutations in Or2aj6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02023:Or2aj6 APN 16 19,443,158 (GRCm39) missense probably benign 0.03
IGL02256:Or2aj6 APN 16 19,443,756 (GRCm39) missense probably benign 0.07
IGL02572:Or2aj6 APN 16 19,443,848 (GRCm39) start codon destroyed probably benign 0.01
IGL02966:Or2aj6 APN 16 19,443,051 (GRCm39) missense probably damaging 1.00
R0062:Or2aj6 UTSW 16 19,443,167 (GRCm39) missense probably benign 0.10
R3614:Or2aj6 UTSW 16 19,443,515 (GRCm39) missense probably damaging 1.00
R4899:Or2aj6 UTSW 16 19,442,950 (GRCm39) missense probably benign 0.33
R5070:Or2aj6 UTSW 16 19,443,742 (GRCm39) missense possibly damaging 0.47
R5334:Or2aj6 UTSW 16 19,443,241 (GRCm39) missense probably benign 0.02
R6490:Or2aj6 UTSW 16 19,443,194 (GRCm39) missense probably benign 0.03
R6632:Or2aj6 UTSW 16 19,443,773 (GRCm39) missense probably benign
R7801:Or2aj6 UTSW 16 19,443,373 (GRCm39) missense probably damaging 0.99
R8858:Or2aj6 UTSW 16 19,443,109 (GRCm39) missense probably damaging 1.00
R9036:Or2aj6 UTSW 16 19,443,295 (GRCm39) nonsense probably null
R9056:Or2aj6 UTSW 16 19,443,791 (GRCm39) missense probably benign 0.03
R9110:Or2aj6 UTSW 16 19,443,743 (GRCm39) missense possibly damaging 0.86
R9576:Or2aj6 UTSW 16 19,442,961 (GRCm39) missense probably damaging 1.00
X0057:Or2aj6 UTSW 16 19,443,676 (GRCm39) missense probably damaging 1.00
X0063:Or2aj6 UTSW 16 19,443,458 (GRCm39) missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TTTTCAAAGCCATGAGGACATC -3'
(R):5'- CCACTCAAGGGCCATTGATC -3'

Sequencing Primer
(F):5'- AGCCATGAGGACATCTTTATTCCG -3'
(R):5'- AAGGGCCATTGATCACTTTTTCTG -3'
Posted On 2017-01-03