Incidental Mutation 'R5718:Epg5'
ID 451321
Institutional Source Beutler Lab
Gene Symbol Epg5
Ensembl Gene ENSMUSG00000039840
Gene Name ectopic P-granules 5 autophagy tethering factor
Synonyms 5430411K18Rik
MMRRC Submission 043338-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.935) question?
Stock # R5718 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 77981680-78078228 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 78029618 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 1327 (C1327Y)
Ref Sequence ENSEMBL: ENSMUSP00000038681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044622]
AlphaFold Q80TA9
Predicted Effect probably damaging
Transcript: ENSMUST00000044622
AA Change: C1327Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840
AA Change: C1327Y

DomainStartEndE-ValueType
low complexity region 299 309 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
low complexity region 1074 1085 N/A INTRINSIC
low complexity region 1499 1516 N/A INTRINSIC
coiled coil region 1600 1626 N/A INTRINSIC
low complexity region 2132 2145 N/A INTRINSIC
low complexity region 2416 2427 N/A INTRINSIC
low complexity region 2454 2469 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 T C 8: 27,603,514 (GRCm39) probably null Het
Ahctf1 G T 1: 179,596,904 (GRCm39) H81N possibly damaging Het
Alyref2 T C 1: 171,331,678 (GRCm39) S152P possibly damaging Het
Arhgef7 C T 8: 11,835,774 (GRCm39) T20I probably damaging Het
Armc3 T G 2: 19,308,610 (GRCm39) Y759* probably null Het
Atg5 A G 10: 44,238,983 (GRCm39) S255G probably benign Het
Atp11b A G 3: 35,891,665 (GRCm39) I1026V probably benign Het
Atp1a2 C A 1: 172,107,009 (GRCm39) K770N probably damaging Het
Bptf G T 11: 107,002,260 (GRCm39) A284E probably damaging Het
Celsr2 A G 3: 108,300,674 (GRCm39) S815P probably benign Het
Chrna5 A G 9: 54,905,389 (GRCm39) H67R probably benign Het
Cic A G 7: 24,972,203 (GRCm39) I645V probably benign Het
Clpx A T 9: 65,207,246 (GRCm39) Q48L probably benign Het
Crhr2 G A 6: 55,069,085 (GRCm39) Q397* probably null Het
Cyp11a1 G A 9: 57,925,508 (GRCm39) V48I probably benign Het
Dchs1 C T 7: 105,404,955 (GRCm39) R2529H probably benign Het
Dnah7c A T 1: 46,787,826 (GRCm39) H3293L possibly damaging Het
Dock6 G T 9: 21,735,789 (GRCm39) D986E probably benign Het
Efcab6 T A 15: 83,788,439 (GRCm39) N952Y probably damaging Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Fbxw18 T C 9: 109,520,636 (GRCm39) E241G probably benign Het
Fsd1 T G 17: 56,297,542 (GRCm39) probably benign Het
Gcnt3 A G 9: 69,941,552 (GRCm39) S339P probably benign Het
Gldc T A 19: 30,088,172 (GRCm39) K829* probably null Het
Gli3 G A 13: 15,652,750 (GRCm39) probably null Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Greb1l G A 18: 10,542,427 (GRCm39) E1341K probably damaging Het
Hmcn1 A T 1: 150,566,351 (GRCm39) C2217* probably null Het
Hmcn1 A T 1: 150,485,417 (GRCm39) I4395N probably damaging Het
Hmgxb3 A G 18: 61,273,909 (GRCm39) M861T probably benign Het
Ift172 A G 5: 31,412,621 (GRCm39) S1545P possibly damaging Het
Jak3 C A 8: 72,136,998 (GRCm39) L725M probably damaging Het
Lrig2 A T 3: 104,375,931 (GRCm39) C90* probably null Het
Mcm7 C T 5: 138,163,081 (GRCm39) R357H possibly damaging Het
Mcoln2 T C 3: 145,887,581 (GRCm39) S333P probably damaging Het
Mrpl22 A T 11: 58,068,109 (GRCm39) I136L probably benign Het
Ncam2 A T 16: 81,386,702 (GRCm39) probably null Het
Ncdn G A 4: 126,643,743 (GRCm39) Q360* probably null Het
Nsun2 A G 13: 69,771,403 (GRCm39) K338E probably benign Het
Obscn T C 11: 58,927,634 (GRCm39) T6105A probably damaging Het
Or2aj6 G A 16: 19,443,139 (GRCm39) S237F probably benign Het
Or8g36 A T 9: 39,422,338 (GRCm39) L226H probably damaging Het
Pcnx4 T A 12: 72,613,968 (GRCm39) F638I possibly damaging Het
Pfn3 T C 13: 55,562,853 (GRCm39) I43V probably benign Het
Pigm C A 1: 172,205,012 (GRCm39) probably null Het
Pkhd1l1 T A 15: 44,408,813 (GRCm39) S2433R probably damaging Het
Pomt1 C A 2: 32,138,704 (GRCm39) A440D possibly damaging Het
Ptprj T C 2: 90,288,613 (GRCm39) D691G probably benign Het
Qrich1 T A 9: 108,406,022 (GRCm39) S72T probably damaging Het
Ralgapa2 T A 2: 146,295,326 (GRCm39) probably null Het
Rarg A C 15: 102,149,502 (GRCm39) S156A probably damaging Het
Rasl11a A G 5: 146,783,954 (GRCm39) K133R probably benign Het
Rcor1 A G 12: 111,068,069 (GRCm39) D158G probably benign Het
Rpn2 C T 2: 157,163,747 (GRCm39) T613M probably damaging Het
Sipa1l2 T A 8: 126,217,987 (GRCm39) H450L probably damaging Het
Slc25a21 T C 12: 56,764,941 (GRCm39) I263V probably benign Het
Slc25a32 A T 15: 38,960,957 (GRCm39) V242E probably benign Het
Slc5a5 T A 8: 71,340,399 (GRCm39) T484S probably benign Het
Tdrd3 T C 14: 87,743,876 (GRCm39) V608A probably benign Het
Thnsl1 C A 2: 21,216,811 (GRCm39) H188Q possibly damaging Het
Tshz1 A T 18: 84,032,649 (GRCm39) H586Q probably damaging Het
Vmn2r27 C T 6: 124,169,103 (GRCm39) A676T possibly damaging Het
Wasf1 G A 10: 40,802,570 (GRCm39) R75Q probably damaging Het
Xbp1 T A 11: 5,471,903 (GRCm39) F10I probably benign Het
Zbtb1 G A 12: 76,433,698 (GRCm39) M561I probably benign Het
Zfp708 T C 13: 67,218,522 (GRCm39) K446E probably benign Het
Other mutations in Epg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Epg5 APN 18 78,055,956 (GRCm39) missense probably damaging 1.00
IGL01778:Epg5 APN 18 78,062,489 (GRCm39) missense probably damaging 0.98
IGL01936:Epg5 APN 18 78,028,316 (GRCm39) missense probably damaging 1.00
IGL02189:Epg5 APN 18 78,056,085 (GRCm39) missense probably damaging 0.99
IGL02323:Epg5 APN 18 78,056,047 (GRCm39) nonsense probably null
IGL02567:Epg5 APN 18 78,076,288 (GRCm39) missense probably damaging 1.00
IGL02805:Epg5 APN 18 78,073,406 (GRCm39) splice site probably benign
IGL03282:Epg5 APN 18 78,029,641 (GRCm39) missense probably benign 0.25
stitch UTSW 18 77,991,514 (GRCm39) nonsense probably null
R0011:Epg5 UTSW 18 77,991,698 (GRCm39) missense probably benign
R0172:Epg5 UTSW 18 78,070,574 (GRCm39) missense probably benign 0.00
R0335:Epg5 UTSW 18 78,029,687 (GRCm39) missense probably benign 0.25
R0380:Epg5 UTSW 18 78,004,056 (GRCm39) missense probably damaging 1.00
R0441:Epg5 UTSW 18 78,066,486 (GRCm39) splice site probably benign
R0443:Epg5 UTSW 18 77,999,118 (GRCm39) splice site probably benign
R0445:Epg5 UTSW 18 78,057,399 (GRCm39) missense possibly damaging 0.87
R0448:Epg5 UTSW 18 78,066,580 (GRCm39) missense probably damaging 1.00
R0892:Epg5 UTSW 18 78,011,843 (GRCm39) missense possibly damaging 0.94
R1081:Epg5 UTSW 18 78,002,748 (GRCm39) missense possibly damaging 0.92
R1183:Epg5 UTSW 18 78,003,926 (GRCm39) missense probably damaging 1.00
R1374:Epg5 UTSW 18 78,024,541 (GRCm39) missense probably benign
R1428:Epg5 UTSW 18 78,005,642 (GRCm39) missense probably damaging 1.00
R1727:Epg5 UTSW 18 78,059,030 (GRCm39) missense possibly damaging 0.94
R1780:Epg5 UTSW 18 78,067,205 (GRCm39) missense probably damaging 0.99
R1801:Epg5 UTSW 18 78,026,705 (GRCm39) missense possibly damaging 0.63
R1864:Epg5 UTSW 18 78,018,246 (GRCm39) missense probably damaging 0.99
R1908:Epg5 UTSW 18 78,002,247 (GRCm39) missense probably benign 0.26
R1909:Epg5 UTSW 18 78,002,247 (GRCm39) missense probably benign 0.26
R1916:Epg5 UTSW 18 78,008,236 (GRCm39) missense probably benign 0.00
R1986:Epg5 UTSW 18 78,025,521 (GRCm39) critical splice acceptor site probably null
R2048:Epg5 UTSW 18 78,067,202 (GRCm39) missense probably damaging 0.98
R2080:Epg5 UTSW 18 77,991,960 (GRCm39) missense probably benign 0.01
R2106:Epg5 UTSW 18 78,034,578 (GRCm39) nonsense probably null
R2144:Epg5 UTSW 18 77,997,412 (GRCm39) missense possibly damaging 0.78
R2151:Epg5 UTSW 18 78,070,517 (GRCm39) missense probably benign
R2217:Epg5 UTSW 18 77,992,287 (GRCm39) missense probably benign
R2424:Epg5 UTSW 18 78,011,828 (GRCm39) missense probably benign 0.05
R2909:Epg5 UTSW 18 78,026,691 (GRCm39) missense probably damaging 1.00
R3725:Epg5 UTSW 18 78,060,894 (GRCm39) missense probably benign 0.00
R3899:Epg5 UTSW 18 78,000,725 (GRCm39) missense probably damaging 1.00
R4019:Epg5 UTSW 18 78,073,665 (GRCm39) missense probably damaging 0.98
R4260:Epg5 UTSW 18 78,058,914 (GRCm39) missense probably damaging 1.00
R4260:Epg5 UTSW 18 78,002,336 (GRCm39) missense possibly damaging 0.50
R4448:Epg5 UTSW 18 78,005,676 (GRCm39) missense probably damaging 1.00
R4475:Epg5 UTSW 18 77,991,723 (GRCm39) missense probably benign
R4612:Epg5 UTSW 18 78,025,629 (GRCm39) missense possibly damaging 0.77
R4666:Epg5 UTSW 18 78,056,079 (GRCm39) missense probably benign 0.45
R4767:Epg5 UTSW 18 78,066,498 (GRCm39) missense possibly damaging 0.67
R4779:Epg5 UTSW 18 78,034,580 (GRCm39) missense probably benign 0.01
R4791:Epg5 UTSW 18 77,992,211 (GRCm39) nonsense probably null
R4797:Epg5 UTSW 18 78,073,614 (GRCm39) missense probably benign 0.00
R4812:Epg5 UTSW 18 78,022,399 (GRCm39) missense probably benign 0.01
R4899:Epg5 UTSW 18 78,028,272 (GRCm39) missense probably damaging 1.00
R5000:Epg5 UTSW 18 77,997,376 (GRCm39) missense probably benign
R5031:Epg5 UTSW 18 78,072,163 (GRCm39) missense probably benign 0.00
R5050:Epg5 UTSW 18 78,019,156 (GRCm39) missense possibly damaging 0.55
R5114:Epg5 UTSW 18 78,038,828 (GRCm39) missense probably benign
R5144:Epg5 UTSW 18 78,058,895 (GRCm39) missense probably damaging 1.00
R5209:Epg5 UTSW 18 77,994,497 (GRCm39) missense probably damaging 1.00
R5213:Epg5 UTSW 18 78,058,049 (GRCm39) missense probably benign 0.01
R5270:Epg5 UTSW 18 78,026,778 (GRCm39) missense possibly damaging 0.79
R5324:Epg5 UTSW 18 78,005,660 (GRCm39) missense possibly damaging 0.94
R5443:Epg5 UTSW 18 78,070,712 (GRCm39) missense possibly damaging 0.55
R5503:Epg5 UTSW 18 77,994,422 (GRCm39) missense possibly damaging 0.81
R5593:Epg5 UTSW 18 78,000,689 (GRCm39) missense probably damaging 1.00
R5773:Epg5 UTSW 18 78,004,040 (GRCm39) missense probably damaging 1.00
R5828:Epg5 UTSW 18 78,064,066 (GRCm39) missense probably damaging 0.99
R5847:Epg5 UTSW 18 78,073,270 (GRCm39) missense probably benign 0.06
R5858:Epg5 UTSW 18 77,991,514 (GRCm39) nonsense probably null
R5914:Epg5 UTSW 18 78,002,847 (GRCm39) critical splice donor site probably null
R6124:Epg5 UTSW 18 78,073,260 (GRCm39) missense probably benign
R6228:Epg5 UTSW 18 77,991,677 (GRCm39) missense possibly damaging 0.90
R6252:Epg5 UTSW 18 78,028,382 (GRCm39) missense probably damaging 1.00
R6269:Epg5 UTSW 18 77,991,585 (GRCm39) missense probably benign
R6312:Epg5 UTSW 18 78,022,426 (GRCm39) missense possibly damaging 0.72
R6320:Epg5 UTSW 18 78,005,613 (GRCm39) missense probably damaging 1.00
R6328:Epg5 UTSW 18 78,072,179 (GRCm39) missense possibly damaging 0.88
R6430:Epg5 UTSW 18 78,019,100 (GRCm39) missense probably damaging 1.00
R6458:Epg5 UTSW 18 77,991,469 (GRCm39) missense probably benign 0.03
R6852:Epg5 UTSW 18 78,056,106 (GRCm39) missense probably damaging 1.00
R6915:Epg5 UTSW 18 78,022,380 (GRCm39) missense probably benign 0.00
R6930:Epg5 UTSW 18 78,057,378 (GRCm39) missense probably damaging 0.99
R6932:Epg5 UTSW 18 77,991,824 (GRCm39) missense probably benign 0.00
R7127:Epg5 UTSW 18 78,072,140 (GRCm39) missense probably damaging 1.00
R7207:Epg5 UTSW 18 77,992,170 (GRCm39) missense probably damaging 1.00
R7225:Epg5 UTSW 18 78,055,917 (GRCm39) missense probably benign 0.45
R7358:Epg5 UTSW 18 78,002,252 (GRCm39) missense possibly damaging 0.78
R7414:Epg5 UTSW 18 78,026,747 (GRCm39) missense possibly damaging 0.65
R7437:Epg5 UTSW 18 78,066,493 (GRCm39) missense probably benign 0.01
R7535:Epg5 UTSW 18 78,076,141 (GRCm39) missense probably benign 0.18
R7586:Epg5 UTSW 18 78,073,275 (GRCm39) missense probably benign
R7651:Epg5 UTSW 18 78,024,615 (GRCm39) nonsense probably null
R7715:Epg5 UTSW 18 78,011,801 (GRCm39) missense probably damaging 1.00
R7753:Epg5 UTSW 18 77,991,560 (GRCm39) missense possibly damaging 0.92
R7981:Epg5 UTSW 18 78,052,929 (GRCm39) critical splice donor site probably null
R8114:Epg5 UTSW 18 78,073,365 (GRCm39) missense probably benign 0.41
R8124:Epg5 UTSW 18 78,008,211 (GRCm39) missense probably benign 0.05
R8307:Epg5 UTSW 18 78,065,894 (GRCm39) missense probably damaging 1.00
R8458:Epg5 UTSW 18 77,991,946 (GRCm39) missense probably benign 0.00
R8751:Epg5 UTSW 18 78,008,225 (GRCm39) missense probably benign 0.28
R8751:Epg5 UTSW 18 78,008,224 (GRCm39) missense possibly damaging 0.65
R8751:Epg5 UTSW 18 78,008,223 (GRCm39) missense probably benign 0.07
R8888:Epg5 UTSW 18 78,056,086 (GRCm39) missense possibly damaging 0.76
R8971:Epg5 UTSW 18 78,022,434 (GRCm39) missense probably damaging 1.00
R9045:Epg5 UTSW 18 77,992,014 (GRCm39) missense probably damaging 1.00
R9291:Epg5 UTSW 18 78,056,065 (GRCm39) nonsense probably null
R9327:Epg5 UTSW 18 77,991,435 (GRCm39) missense probably benign 0.00
R9365:Epg5 UTSW 18 77,997,957 (GRCm39) missense probably damaging 1.00
R9742:Epg5 UTSW 18 78,024,170 (GRCm39) missense probably damaging 1.00
X0023:Epg5 UTSW 18 78,011,872 (GRCm39) missense probably damaging 0.99
X0060:Epg5 UTSW 18 78,005,700 (GRCm39) missense possibly damaging 0.94
Z1088:Epg5 UTSW 18 78,002,354 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAACTGTGAAATCAGAGCCAGTTG -3'
(R):5'- GCAGCCCATCTTACCTCACTAG -3'

Sequencing Primer
(F):5'- TCAGAGCCAGTTGAGAGGAAC -3'
(R):5'- ACTAGTTCCCTGTGCAGTTCTGG -3'
Posted On 2017-01-03