Incidental Mutation 'R5718:Gldc'
ID 451323
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Name glycine decarboxylase
Synonyms b2b2679Clo, D030049L12Rik, D19Wsu57e
MMRRC Submission 043338-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5718 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 30075847-30152829 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 30088172 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 829 (K829*)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
AlphaFold Q91W43
Predicted Effect probably null
Transcript: ENSMUST00000025778
AA Change: K829*
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: K829*

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 T C 8: 27,603,514 (GRCm39) probably null Het
Ahctf1 G T 1: 179,596,904 (GRCm39) H81N possibly damaging Het
Alyref2 T C 1: 171,331,678 (GRCm39) S152P possibly damaging Het
Arhgef7 C T 8: 11,835,774 (GRCm39) T20I probably damaging Het
Armc3 T G 2: 19,308,610 (GRCm39) Y759* probably null Het
Atg5 A G 10: 44,238,983 (GRCm39) S255G probably benign Het
Atp11b A G 3: 35,891,665 (GRCm39) I1026V probably benign Het
Atp1a2 C A 1: 172,107,009 (GRCm39) K770N probably damaging Het
Bptf G T 11: 107,002,260 (GRCm39) A284E probably damaging Het
Celsr2 A G 3: 108,300,674 (GRCm39) S815P probably benign Het
Chrna5 A G 9: 54,905,389 (GRCm39) H67R probably benign Het
Cic A G 7: 24,972,203 (GRCm39) I645V probably benign Het
Clpx A T 9: 65,207,246 (GRCm39) Q48L probably benign Het
Crhr2 G A 6: 55,069,085 (GRCm39) Q397* probably null Het
Cyp11a1 G A 9: 57,925,508 (GRCm39) V48I probably benign Het
Dchs1 C T 7: 105,404,955 (GRCm39) R2529H probably benign Het
Dnah7c A T 1: 46,787,826 (GRCm39) H3293L possibly damaging Het
Dock6 G T 9: 21,735,789 (GRCm39) D986E probably benign Het
Efcab6 T A 15: 83,788,439 (GRCm39) N952Y probably damaging Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Epg5 G A 18: 78,029,618 (GRCm39) C1327Y probably damaging Het
Fbxw18 T C 9: 109,520,636 (GRCm39) E241G probably benign Het
Fsd1 T G 17: 56,297,542 (GRCm39) probably benign Het
Gcnt3 A G 9: 69,941,552 (GRCm39) S339P probably benign Het
Gli3 G A 13: 15,652,750 (GRCm39) probably null Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Greb1l G A 18: 10,542,427 (GRCm39) E1341K probably damaging Het
Hmcn1 A T 1: 150,566,351 (GRCm39) C2217* probably null Het
Hmcn1 A T 1: 150,485,417 (GRCm39) I4395N probably damaging Het
Hmgxb3 A G 18: 61,273,909 (GRCm39) M861T probably benign Het
Ift172 A G 5: 31,412,621 (GRCm39) S1545P possibly damaging Het
Jak3 C A 8: 72,136,998 (GRCm39) L725M probably damaging Het
Lrig2 A T 3: 104,375,931 (GRCm39) C90* probably null Het
Mcm7 C T 5: 138,163,081 (GRCm39) R357H possibly damaging Het
Mcoln2 T C 3: 145,887,581 (GRCm39) S333P probably damaging Het
Mrpl22 A T 11: 58,068,109 (GRCm39) I136L probably benign Het
Ncam2 A T 16: 81,386,702 (GRCm39) probably null Het
Ncdn G A 4: 126,643,743 (GRCm39) Q360* probably null Het
Nsun2 A G 13: 69,771,403 (GRCm39) K338E probably benign Het
Obscn T C 11: 58,927,634 (GRCm39) T6105A probably damaging Het
Or2aj6 G A 16: 19,443,139 (GRCm39) S237F probably benign Het
Or8g36 A T 9: 39,422,338 (GRCm39) L226H probably damaging Het
Pcnx4 T A 12: 72,613,968 (GRCm39) F638I possibly damaging Het
Pfn3 T C 13: 55,562,853 (GRCm39) I43V probably benign Het
Pigm C A 1: 172,205,012 (GRCm39) probably null Het
Pkhd1l1 T A 15: 44,408,813 (GRCm39) S2433R probably damaging Het
Pomt1 C A 2: 32,138,704 (GRCm39) A440D possibly damaging Het
Ptprj T C 2: 90,288,613 (GRCm39) D691G probably benign Het
Qrich1 T A 9: 108,406,022 (GRCm39) S72T probably damaging Het
Ralgapa2 T A 2: 146,295,326 (GRCm39) probably null Het
Rarg A C 15: 102,149,502 (GRCm39) S156A probably damaging Het
Rasl11a A G 5: 146,783,954 (GRCm39) K133R probably benign Het
Rcor1 A G 12: 111,068,069 (GRCm39) D158G probably benign Het
Rpn2 C T 2: 157,163,747 (GRCm39) T613M probably damaging Het
Sipa1l2 T A 8: 126,217,987 (GRCm39) H450L probably damaging Het
Slc25a21 T C 12: 56,764,941 (GRCm39) I263V probably benign Het
Slc25a32 A T 15: 38,960,957 (GRCm39) V242E probably benign Het
Slc5a5 T A 8: 71,340,399 (GRCm39) T484S probably benign Het
Tdrd3 T C 14: 87,743,876 (GRCm39) V608A probably benign Het
Thnsl1 C A 2: 21,216,811 (GRCm39) H188Q possibly damaging Het
Tshz1 A T 18: 84,032,649 (GRCm39) H586Q probably damaging Het
Vmn2r27 C T 6: 124,169,103 (GRCm39) A676T possibly damaging Het
Wasf1 G A 10: 40,802,570 (GRCm39) R75Q probably damaging Het
Xbp1 T A 11: 5,471,903 (GRCm39) F10I probably benign Het
Zbtb1 G A 12: 76,433,698 (GRCm39) M561I probably benign Het
Zfp708 T C 13: 67,218,522 (GRCm39) K446E probably benign Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30,092,640 (GRCm39) missense probably damaging 1.00
IGL01016:Gldc APN 19 30,110,893 (GRCm39) missense possibly damaging 0.93
IGL01112:Gldc APN 19 30,135,913 (GRCm39) critical splice donor site probably null
IGL01510:Gldc APN 19 30,091,121 (GRCm39) critical splice donor site probably null
IGL01516:Gldc APN 19 30,076,432 (GRCm39) missense probably damaging 1.00
IGL01598:Gldc APN 19 30,111,156 (GRCm39) missense probably damaging 1.00
IGL01646:Gldc APN 19 30,078,165 (GRCm39) missense possibly damaging 0.61
IGL02024:Gldc APN 19 30,078,227 (GRCm39) missense probably damaging 1.00
IGL02125:Gldc APN 19 30,124,641 (GRCm39) missense probably benign 0.03
IGL02548:Gldc APN 19 30,077,299 (GRCm39) missense probably benign
IGL02711:Gldc APN 19 30,122,546 (GRCm39) critical splice donor site probably null
IGL02818:Gldc APN 19 30,113,909 (GRCm39) missense probably damaging 0.99
IGL02982:Gldc APN 19 30,122,545 (GRCm39) critical splice donor site probably null
IGL03165:Gldc APN 19 30,076,393 (GRCm39) missense possibly damaging 0.61
jojoba UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
miserable UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
Urchin UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
I2289:Gldc UTSW 19 30,124,576 (GRCm39) nonsense probably null
R0180:Gldc UTSW 19 30,078,217 (GRCm39) missense possibly damaging 0.95
R0269:Gldc UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
R0277:Gldc UTSW 19 30,093,851 (GRCm39) missense possibly damaging 0.84
R1085:Gldc UTSW 19 30,128,828 (GRCm39) missense probably damaging 1.00
R1159:Gldc UTSW 19 30,138,162 (GRCm39) intron probably benign
R1500:Gldc UTSW 19 30,091,225 (GRCm39) missense possibly damaging 0.88
R1507:Gldc UTSW 19 30,096,038 (GRCm39) missense probably damaging 1.00
R1592:Gldc UTSW 19 30,138,077 (GRCm39) intron probably benign
R1593:Gldc UTSW 19 30,091,150 (GRCm39) missense probably damaging 1.00
R1675:Gldc UTSW 19 30,120,853 (GRCm39) missense probably damaging 1.00
R1869:Gldc UTSW 19 30,116,732 (GRCm39) missense probably benign
R1965:Gldc UTSW 19 30,114,513 (GRCm39) nonsense probably null
R2312:Gldc UTSW 19 30,078,226 (GRCm39) missense probably damaging 0.98
R2425:Gldc UTSW 19 30,109,190 (GRCm39) missense probably damaging 1.00
R3836:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3837:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3839:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R4191:Gldc UTSW 19 30,123,058 (GRCm39) missense probably damaging 0.96
R4380:Gldc UTSW 19 30,138,168 (GRCm39) intron probably benign
R4508:Gldc UTSW 19 30,120,807 (GRCm39) missense probably damaging 1.00
R4570:Gldc UTSW 19 30,151,839 (GRCm39) missense probably benign
R4655:Gldc UTSW 19 30,138,102 (GRCm39) intron probably benign
R4842:Gldc UTSW 19 30,111,132 (GRCm39) missense possibly damaging 0.94
R5070:Gldc UTSW 19 30,095,998 (GRCm39) missense possibly damaging 0.84
R5085:Gldc UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
R5268:Gldc UTSW 19 30,123,125 (GRCm39) missense probably damaging 0.96
R5368:Gldc UTSW 19 30,135,921 (GRCm39) missense probably benign
R5878:Gldc UTSW 19 30,120,867 (GRCm39) splice site probably null
R6192:Gldc UTSW 19 30,111,172 (GRCm39) missense probably damaging 0.98
R6453:Gldc UTSW 19 30,093,917 (GRCm39) missense probably damaging 0.99
R6777:Gldc UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
R6865:Gldc UTSW 19 30,111,162 (GRCm39) missense possibly damaging 0.92
R7332:Gldc UTSW 19 30,093,926 (GRCm39) missense probably damaging 0.99
R7390:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.46
R7647:Gldc UTSW 19 30,096,067 (GRCm39) missense probably damaging 0.96
R8081:Gldc UTSW 19 30,135,987 (GRCm39) frame shift probably null
R8171:Gldc UTSW 19 30,111,161 (GRCm39) missense probably benign 0.24
R8321:Gldc UTSW 19 30,120,807 (GRCm39) nonsense probably null
R8374:Gldc UTSW 19 30,114,594 (GRCm39) missense probably damaging 1.00
R8503:Gldc UTSW 19 30,077,254 (GRCm39) missense probably benign 0.26
R8510:Gldc UTSW 19 30,093,905 (GRCm39) missense probably damaging 1.00
R8785:Gldc UTSW 19 30,092,634 (GRCm39) missense probably damaging 1.00
R8818:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8820:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8829:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8830:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8859:Gldc UTSW 19 30,116,779 (GRCm39) missense probably damaging 1.00
R8887:Gldc UTSW 19 30,111,156 (GRCm39) missense possibly damaging 0.94
R8935:Gldc UTSW 19 30,109,093 (GRCm39) missense probably benign 0.00
R8940:Gldc UTSW 19 30,128,884 (GRCm39) missense probably benign
R9070:Gldc UTSW 19 30,080,404 (GRCm39) missense probably damaging 1.00
R9100:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.81
R9144:Gldc UTSW 19 30,114,593 (GRCm39) missense
R9163:Gldc UTSW 19 30,111,686 (GRCm39) missense probably benign 0.13
R9429:Gldc UTSW 19 30,091,172 (GRCm39) missense possibly damaging 0.88
Z1177:Gldc UTSW 19 30,123,148 (GRCm39) missense possibly damaging 0.61
Z1177:Gldc UTSW 19 30,088,179 (GRCm39) missense probably damaging 0.99
Z1177:Gldc UTSW 19 30,088,178 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAATTAAAGCATCCCTCTCACCTTTC -3'
(R):5'- GTGTGGAGGAGACTAACAGATTTC -3'

Sequencing Primer
(F):5'- TCTAGCATAGTTACATAGGAACCAC -3'
(R):5'- GGAGACTAACAGATTTCCTTTCTGG -3'
Posted On 2017-01-03