Incidental Mutation 'R5718:Gldc'
ID451323
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Nameglycine decarboxylase
SynonymsD030049L12Rik, D19Wsu57e
MMRRC Submission 043338-MU
Accession Numbers

Genbank: NM_138595.1

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5718 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location30098449-30175418 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 30110772 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 829 (K829*)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
Predicted Effect probably null
Transcript: ENSMUST00000025778
AA Change: K829*
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: K829*

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 T C 8: 27,113,486 probably null Het
Ahctf1 G T 1: 179,769,339 H81N possibly damaging Het
Alyref2 T C 1: 171,504,110 S152P possibly damaging Het
Arhgef7 C T 8: 11,785,774 T20I probably damaging Het
Armc3 T G 2: 19,303,799 Y759* probably null Het
Atg5 A G 10: 44,362,987 S255G probably benign Het
Atp11b A G 3: 35,837,516 I1026V probably benign Het
Atp1a2 C A 1: 172,279,442 K770N probably damaging Het
Bptf G T 11: 107,111,434 A284E probably damaging Het
Celsr2 A G 3: 108,393,358 S815P probably benign Het
Chrna5 A G 9: 54,998,105 H67R probably benign Het
Cic A G 7: 25,272,778 I645V probably benign Het
Clpx A T 9: 65,299,964 Q48L probably benign Het
Crhr2 G A 6: 55,092,100 Q397* probably null Het
Cyp11a1 G A 9: 58,018,225 V48I probably benign Het
Dchs1 C T 7: 105,755,748 R2529H probably benign Het
Dnah7c A T 1: 46,748,666 H3293L possibly damaging Het
Dock6 G T 9: 21,824,493 D986E probably benign Het
Efcab6 T A 15: 83,904,238 N952Y probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epg5 G A 18: 77,986,403 C1327Y probably damaging Het
Fbxw18 T C 9: 109,691,568 E241G probably benign Het
Fsd1 T G 17: 55,990,542 probably benign Het
Gcnt3 A G 9: 70,034,270 S339P probably benign Het
Gli3 G A 13: 15,478,165 probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Hmcn1 A T 1: 150,609,666 I4395N probably damaging Het
Hmcn1 A T 1: 150,690,600 C2217* probably null Het
Hmgxb3 A G 18: 61,140,837 M861T probably benign Het
Ift172 A G 5: 31,255,277 S1545P possibly damaging Het
Jak3 C A 8: 71,684,354 L725M probably damaging Het
Lrig2 A T 3: 104,468,615 C90* probably null Het
Mcm7 C T 5: 138,164,819 R357H possibly damaging Het
Mcoln2 T C 3: 146,181,826 S333P probably damaging Het
Mrpl22 A T 11: 58,177,283 I136L probably benign Het
Ncam2 A T 16: 81,589,814 probably null Het
Ncdn G A 4: 126,749,950 Q360* probably null Het
Nsun2 A G 13: 69,623,284 K338E probably benign Het
Obscn T C 11: 59,036,808 T6105A probably damaging Het
Olfr171 G A 16: 19,624,389 S237F probably benign Het
Olfr957 A T 9: 39,511,042 L226H probably damaging Het
Pcnx4 T A 12: 72,567,194 F638I possibly damaging Het
Pfn3 T C 13: 55,415,040 I43V probably benign Het
Pigm C A 1: 172,377,445 probably null Het
Pkhd1l1 T A 15: 44,545,417 S2433R probably damaging Het
Pomt1 C A 2: 32,248,692 A440D possibly damaging Het
Ptprj T C 2: 90,458,269 D691G probably benign Het
Qrich1 T A 9: 108,528,823 S72T probably damaging Het
Ralgapa2 T A 2: 146,453,406 probably null Het
Rarg A C 15: 102,241,067 S156A probably damaging Het
Rasl11a A G 5: 146,847,144 K133R probably benign Het
Rcor1 A G 12: 111,101,635 D158G probably benign Het
Rpn2 C T 2: 157,321,827 T613M probably damaging Het
Sipa1l2 T A 8: 125,491,248 H450L probably damaging Het
Slc25a21 T C 12: 56,718,156 I263V probably benign Het
Slc25a32 A T 15: 39,097,562 V242E probably benign Het
Slc5a5 T A 8: 70,887,755 T484S probably benign Het
Tdrd3 T C 14: 87,506,440 V608A probably benign Het
Thnsl1 C A 2: 21,212,000 H188Q possibly damaging Het
Tshz1 A T 18: 84,014,524 H586Q probably damaging Het
Vmn2r27 C T 6: 124,192,144 A676T possibly damaging Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Xbp1 T A 11: 5,521,903 F10I probably benign Het
Zbtb1 G A 12: 76,386,924 M561I probably benign Het
Zfp708 T C 13: 67,070,458 K446E probably benign Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30115240 missense probably damaging 1.00
IGL01016:Gldc APN 19 30133493 missense possibly damaging 0.93
IGL01112:Gldc APN 19 30158513 critical splice donor site probably null
IGL01510:Gldc APN 19 30113721 critical splice donor site probably null
IGL01516:Gldc APN 19 30099032 missense probably damaging 1.00
IGL01598:Gldc APN 19 30133756 missense probably damaging 1.00
IGL01646:Gldc APN 19 30100765 missense possibly damaging 0.61
IGL02024:Gldc APN 19 30100827 missense probably damaging 1.00
IGL02125:Gldc APN 19 30147241 missense probably benign 0.03
IGL02548:Gldc APN 19 30099899 missense probably benign
IGL02711:Gldc APN 19 30145146 critical splice donor site probably null
IGL02818:Gldc APN 19 30136509 missense probably damaging 0.99
IGL02982:Gldc APN 19 30145145 critical splice donor site probably null
IGL03165:Gldc APN 19 30098993 missense possibly damaging 0.61
jojoba UTSW 19 30133512 missense probably damaging 1.00
miserable UTSW 19 30151536 missense probably damaging 1.00
Urchin UTSW 19 30118602 missense probably damaging 0.98
I2289:Gldc UTSW 19 30147176 nonsense probably null
R0180:Gldc UTSW 19 30100817 missense possibly damaging 0.95
R0269:Gldc UTSW 19 30118602 missense probably damaging 0.98
R0277:Gldc UTSW 19 30116451 missense possibly damaging 0.84
R1085:Gldc UTSW 19 30151428 missense probably damaging 1.00
R1159:Gldc UTSW 19 30160762 intron probably benign
R1500:Gldc UTSW 19 30113825 missense possibly damaging 0.88
R1507:Gldc UTSW 19 30118638 missense probably damaging 1.00
R1592:Gldc UTSW 19 30160677 intron probably benign
R1593:Gldc UTSW 19 30113750 missense probably damaging 1.00
R1675:Gldc UTSW 19 30143453 missense probably damaging 1.00
R1869:Gldc UTSW 19 30139332 missense probably benign
R1965:Gldc UTSW 19 30137113 nonsense probably null
R2312:Gldc UTSW 19 30100826 missense probably damaging 0.98
R2425:Gldc UTSW 19 30131790 missense probably damaging 1.00
R3836:Gldc UTSW 19 30118675 splice site probably benign
R3837:Gldc UTSW 19 30118675 splice site probably benign
R3839:Gldc UTSW 19 30118675 splice site probably benign
R4191:Gldc UTSW 19 30145658 missense probably damaging 0.96
R4380:Gldc UTSW 19 30160768 intron probably benign
R4508:Gldc UTSW 19 30143407 missense probably damaging 1.00
R4570:Gldc UTSW 19 30174439 missense probably benign
R4655:Gldc UTSW 19 30160702 intron probably benign
R4842:Gldc UTSW 19 30133732 missense possibly damaging 0.94
R5070:Gldc UTSW 19 30118598 missense possibly damaging 0.84
R5085:Gldc UTSW 19 30151536 missense probably damaging 1.00
R5268:Gldc UTSW 19 30145725 missense probably damaging 0.96
R5368:Gldc UTSW 19 30158521 missense probably benign
R5878:Gldc UTSW 19 30143467 splice site probably null
R6192:Gldc UTSW 19 30133772 missense probably damaging 0.98
R6453:Gldc UTSW 19 30116517 missense probably damaging 0.99
R6777:Gldc UTSW 19 30133512 missense probably damaging 1.00
R6865:Gldc UTSW 19 30133762 missense possibly damaging 0.92
R7332:Gldc UTSW 19 30116526 missense probably damaging 0.99
R7390:Gldc UTSW 19 30099914 missense possibly damaging 0.46
R7647:Gldc UTSW 19 30118667 missense probably damaging 0.96
R8081:Gldc UTSW 19 30158587 frame shift probably null
R8171:Gldc UTSW 19 30133761 missense probably benign 0.24
R8321:Gldc UTSW 19 30143407 nonsense probably null
R8374:Gldc UTSW 19 30137194 missense probably damaging 1.00
R8503:Gldc UTSW 19 30099854 missense probably benign 0.26
R8510:Gldc UTSW 19 30116505 missense probably damaging 1.00
R8785:Gldc UTSW 19 30115234 missense probably damaging 1.00
R8818:Gldc UTSW 19 30100812 missense probably benign 0.05
R8820:Gldc UTSW 19 30100812 missense probably benign 0.05
R8829:Gldc UTSW 19 30100812 missense probably benign 0.05
R8830:Gldc UTSW 19 30100812 missense probably benign 0.05
R8859:Gldc UTSW 19 30139379 missense probably damaging 1.00
R8887:Gldc UTSW 19 30133756 missense possibly damaging 0.94
R8935:Gldc UTSW 19 30131693 missense probably benign 0.00
R8940:Gldc UTSW 19 30151484 missense probably benign
Z1177:Gldc UTSW 19 30110778 missense probably damaging 1.00
Z1177:Gldc UTSW 19 30110779 missense probably damaging 0.99
Z1177:Gldc UTSW 19 30145748 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GAAATTAAAGCATCCCTCTCACCTTTC -3'
(R):5'- GTGTGGAGGAGACTAACAGATTTC -3'

Sequencing Primer
(F):5'- TCTAGCATAGTTACATAGGAACCAC -3'
(R):5'- GGAGACTAACAGATTTCCTTTCTGG -3'
Posted On2017-01-03