Incidental Mutation 'R0551:Sntg1'
ID 45133
Institutional Source Beutler Lab
Gene Symbol Sntg1
Ensembl Gene ENSMUSG00000025909
Gene Name syntrophin, gamma 1
Synonyms G1SYN, SYN4
MMRRC Submission 038743-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R0551 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 8431699-9370103 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 8624960 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 279 (V279L)
Ref Sequence ENSEMBL: ENSMUSP00000141839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115488] [ENSMUST00000132064] [ENSMUST00000140295] [ENSMUST00000140302] [ENSMUST00000191683]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000115488
AA Change: V280L

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111151
Gene: ENSMUSG00000025909
AA Change: V280L

DomainStartEndE-ValueType
Blast:Tubulin_C 6 54 3e-20 BLAST
PDZ 66 140 3.41e-17 SMART
PH 180 266 8.91e0 SMART
PH 284 392 7.66e-1 SMART
low complexity region 440 449 N/A INTRINSIC
low complexity region 499 514 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000132064
AA Change: V279L

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122134
Gene: ENSMUSG00000025909
AA Change: V279L

DomainStartEndE-ValueType
Blast:Tubulin_C 6 54 3e-20 BLAST
PDZ 66 139 1.84e-13 SMART
PH 179 265 8.91e0 SMART
PH 283 391 7.66e-1 SMART
low complexity region 439 448 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000140295
AA Change: V280L

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118101
Gene: ENSMUSG00000025909
AA Change: V280L

DomainStartEndE-ValueType
Blast:Tubulin_C 17 65 3e-20 BLAST
PDZ 77 150 1.84e-13 SMART
PH 190 276 8.91e0 SMART
PH 294 402 7.66e-1 SMART
low complexity region 450 459 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140302
SMART Domains Protein: ENSMUSP00000117397
Gene: ENSMUSG00000025909

DomainStartEndE-ValueType
PDZ 66 140 3.41e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000191683
AA Change: V279L

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141839
Gene: ENSMUSG00000025909
AA Change: V279L

DomainStartEndE-ValueType
Blast:Tubulin_C 6 54 3e-20 BLAST
PDZ 66 139 1.84e-13 SMART
PH 179 265 8.91e0 SMART
PH 283 391 7.66e-1 SMART
low complexity region 439 448 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
Meta Mutation Damage Score 0.0806 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the syntrophin family. Syntrophins are cytoplasmic peripheral membrane proteins that typically contain 2 pleckstrin homology (PH) domains, a PDZ domain that bisects the first PH domain, and a C-terminal domain that mediates dystrophin binding. This family member plays a role in mediating gamma-enolase trafficking to the plasma membrane and in enhancing its neurotrophic activity. Mutations in this gene are associated with idiopathic scoliosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,384,598 (GRCm39) T456S probably benign Het
Acmsd A T 1: 127,694,070 (GRCm39) K333N probably benign Het
Adcy2 T A 13: 68,944,658 (GRCm39) K241N probably damaging Het
Aebp1 A G 11: 5,817,955 (GRCm39) I77V probably benign Het
Albfm1 C T 5: 90,720,578 (GRCm39) P250S probably damaging Het
Ankrd35 A G 3: 96,591,276 (GRCm39) T521A probably benign Het
Arap2 C T 5: 62,798,666 (GRCm39) probably null Het
Arfgap3 A T 15: 83,227,338 (GRCm39) C25S probably damaging Het
Arhgap20 T A 9: 51,737,125 (GRCm39) probably benign Het
Arhgap39 C T 15: 76,619,086 (GRCm39) D833N probably damaging Het
Auts2 T C 5: 131,469,307 (GRCm39) E446G possibly damaging Het
Brwd1 C T 16: 95,837,174 (GRCm39) R886H probably damaging Het
Carm1 G A 9: 21,491,787 (GRCm39) probably null Het
Cdc5l G A 17: 45,726,610 (GRCm39) R321W probably damaging Het
Cfap54 A T 10: 92,860,984 (GRCm39) M841K probably benign Het
Clca4b T A 3: 144,634,387 (GRCm39) T69S probably damaging Het
Cpox A G 16: 58,495,753 (GRCm39) I357V probably benign Het
Diaph3 C A 14: 87,147,536 (GRCm39) V711L probably benign Het
Fabp3-ps1 T C 10: 86,567,904 (GRCm39) probably benign Het
Fam120b A T 17: 15,651,905 (GRCm39) probably benign Het
Fcho1 A G 8: 72,164,818 (GRCm39) S488P probably benign Het
Flcn A G 11: 59,686,574 (GRCm39) probably null Het
Flt3l A G 7: 44,781,690 (GRCm39) W234R probably damaging Het
Fzd7 G T 1: 59,522,443 (GRCm39) V109L probably damaging Het
G3bp1 A G 11: 55,379,969 (GRCm39) N101S probably benign Het
Gadd45g A G 13: 52,001,963 (GRCm39) E143G probably damaging Het
Ganab T G 19: 8,884,644 (GRCm39) I149S probably benign Het
Garnl3 A G 2: 32,906,750 (GRCm39) S413P probably damaging Het
Glis1 C T 4: 107,425,316 (GRCm39) probably null Het
Gm11563 A G 11: 99,549,539 (GRCm39) S72P unknown Het
Gpd1 T G 15: 99,618,510 (GRCm39) I188S possibly damaging Het
Gria2 A G 3: 80,639,333 (GRCm39) probably benign Het
Hpcal4 G T 4: 123,082,848 (GRCm39) A65S possibly damaging Het
Igsf10 G A 3: 59,236,089 (GRCm39) T1364I probably benign Het
Kdm4a T C 4: 117,995,428 (GRCm39) *1065W probably null Het
Klkb1 A G 8: 45,731,003 (GRCm39) probably null Het
Lipo3 T C 19: 33,557,951 (GRCm39) D147G probably damaging Het
Lrp1 A G 10: 127,407,827 (GRCm39) S1821P probably benign Het
Macroh2a2 A G 10: 61,576,945 (GRCm39) S308P probably damaging Het
Manba T C 3: 135,223,734 (GRCm39) I207T probably damaging Het
Mark3 T A 12: 111,600,068 (GRCm39) S428T probably benign Het
Mfsd4a G A 1: 131,969,657 (GRCm39) T348I probably damaging Het
Mybbp1a A G 11: 72,339,202 (GRCm39) M880V probably benign Het
N4bp2 T A 5: 65,977,684 (GRCm39) probably null Het
Nrdc T G 4: 108,904,905 (GRCm39) I712S probably damaging Het
Nup210 G A 6: 90,998,466 (GRCm39) R774C possibly damaging Het
Obscn G A 11: 58,998,688 (GRCm39) R1395* probably null Het
Or5b102 T A 19: 13,041,658 (GRCm39) D294E probably benign Het
Pcdh7 T C 5: 57,879,336 (GRCm39) Y964H probably damaging Het
Pgap6 C A 17: 26,339,576 (GRCm39) Q605K probably damaging Het
Plin4 T C 17: 56,413,756 (GRCm39) T290A probably benign Het
Ppara T C 15: 85,671,306 (GRCm39) probably benign Het
Psg21 T G 7: 18,386,565 (GRCm39) probably null Het
Ptar1 C A 19: 23,697,704 (GRCm39) N405K probably benign Het
Ralgps2 A G 1: 156,660,233 (GRCm39) probably null Het
Rnf6 T A 5: 146,148,205 (GRCm39) N271I possibly damaging Het
Sis T C 3: 72,832,740 (GRCm39) D1019G possibly damaging Het
Slc37a3 A G 6: 39,329,688 (GRCm39) probably benign Het
Slc49a3 A G 5: 108,592,331 (GRCm39) probably benign Het
Slc6a12 G A 6: 121,333,877 (GRCm39) V238I probably damaging Het
Sorbs1 T A 19: 40,300,260 (GRCm39) E567D probably damaging Het
Sp110 C A 1: 85,516,821 (GRCm39) probably benign Het
Ssu2 A G 6: 112,357,515 (GRCm39) V175A possibly damaging Het
Stk36 G A 1: 74,655,780 (GRCm39) E428K probably benign Het
Teddm1b A T 1: 153,751,090 (GRCm39) I300F possibly damaging Het
Thy1 T C 9: 43,958,645 (GRCm39) V129A probably damaging Het
Tiam2 T A 17: 3,479,229 (GRCm39) M654K probably damaging Het
Tmem69 T C 4: 116,410,470 (GRCm39) S167G probably benign Het
Tmem81 C G 1: 132,435,567 (GRCm39) I124M probably damaging Het
Tspan10 A G 11: 120,335,244 (GRCm39) D118G probably damaging Het
Tspo2 A G 17: 48,755,841 (GRCm39) probably benign Het
Ttn G A 2: 76,738,672 (GRCm39) Q4002* probably null Het
Tyro3 G A 2: 119,647,385 (GRCm39) R834Q probably damaging Het
Ugt2b1 T C 5: 87,073,943 (GRCm39) K139E probably benign Het
Vmn1r9 A T 6: 57,048,524 (GRCm39) I200F probably benign Het
Other mutations in Sntg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Sntg1 APN 1 8,665,634 (GRCm39) critical splice donor site probably null
IGL01536:Sntg1 APN 1 8,653,424 (GRCm39) splice site probably null
IGL01558:Sntg1 APN 1 8,533,612 (GRCm39) splice site probably benign
IGL01649:Sntg1 APN 1 8,752,193 (GRCm39) splice site probably benign
IGL02230:Sntg1 APN 1 8,752,195 (GRCm39) critical splice donor site probably null
IGL02252:Sntg1 APN 1 8,484,452 (GRCm39) missense probably benign 0.00
IGL02804:Sntg1 APN 1 8,874,182 (GRCm39) utr 5 prime probably benign
IGL03165:Sntg1 APN 1 8,515,328 (GRCm39) missense probably damaging 1.00
IGL03400:Sntg1 APN 1 8,533,638 (GRCm39) missense probably damaging 0.98
R0013:Sntg1 UTSW 1 8,533,686 (GRCm39) missense probably damaging 1.00
R0079:Sntg1 UTSW 1 8,749,286 (GRCm39) splice site probably benign
R0379:Sntg1 UTSW 1 8,853,048 (GRCm39) missense probably damaging 1.00
R1081:Sntg1 UTSW 1 8,515,343 (GRCm39) missense possibly damaging 0.92
R1645:Sntg1 UTSW 1 8,874,155 (GRCm39) missense probably benign 0.06
R2089:Sntg1 UTSW 1 8,665,763 (GRCm39) missense probably benign 0.04
R2091:Sntg1 UTSW 1 8,665,763 (GRCm39) missense probably benign 0.04
R2091:Sntg1 UTSW 1 8,665,763 (GRCm39) missense probably benign 0.04
R3951:Sntg1 UTSW 1 8,853,125 (GRCm39) splice site probably benign
R4152:Sntg1 UTSW 1 8,653,569 (GRCm39) splice site probably null
R4153:Sntg1 UTSW 1 8,653,569 (GRCm39) splice site probably null
R4154:Sntg1 UTSW 1 8,653,569 (GRCm39) splice site probably null
R4847:Sntg1 UTSW 1 8,665,706 (GRCm39) missense possibly damaging 0.93
R4888:Sntg1 UTSW 1 8,433,818 (GRCm39) missense probably damaging 0.98
R4947:Sntg1 UTSW 1 8,853,022 (GRCm39) missense probably damaging 1.00
R5065:Sntg1 UTSW 1 8,433,663 (GRCm39) utr 3 prime probably benign
R5293:Sntg1 UTSW 1 8,665,757 (GRCm39) missense probably damaging 1.00
R5550:Sntg1 UTSW 1 8,695,008 (GRCm39) missense probably damaging 1.00
R5558:Sntg1 UTSW 1 8,484,495 (GRCm39) missense possibly damaging 0.94
R5687:Sntg1 UTSW 1 8,533,667 (GRCm39) missense possibly damaging 0.94
R5759:Sntg1 UTSW 1 8,484,494 (GRCm39) missense probably benign 0.00
R6075:Sntg1 UTSW 1 8,749,338 (GRCm39) makesense probably null
R6266:Sntg1 UTSW 1 8,624,953 (GRCm39) missense possibly damaging 0.56
R6313:Sntg1 UTSW 1 8,515,248 (GRCm39) splice site probably null
R6345:Sntg1 UTSW 1 8,653,508 (GRCm39) missense possibly damaging 0.85
R6490:Sntg1 UTSW 1 8,653,508 (GRCm39) missense possibly damaging 0.85
R6571:Sntg1 UTSW 1 8,433,752 (GRCm39) utr 3 prime probably benign
R6736:Sntg1 UTSW 1 8,515,274 (GRCm39) missense probably benign 0.16
R7112:Sntg1 UTSW 1 8,518,289 (GRCm39) missense possibly damaging 0.93
R7266:Sntg1 UTSW 1 8,752,243 (GRCm39) missense possibly damaging 0.81
R7414:Sntg1 UTSW 1 8,518,289 (GRCm39) missense probably damaging 1.00
R7583:Sntg1 UTSW 1 8,515,249 (GRCm39) critical splice donor site probably null
R7892:Sntg1 UTSW 1 8,853,024 (GRCm39) missense probably damaging 1.00
R7961:Sntg1 UTSW 1 8,433,794 (GRCm39) missense probably damaging 0.96
R7968:Sntg1 UTSW 1 8,535,760 (GRCm39) nonsense probably null
R8009:Sntg1 UTSW 1 8,433,794 (GRCm39) missense probably damaging 0.96
R8888:Sntg1 UTSW 1 8,748,074 (GRCm39) critical splice acceptor site probably null
R8895:Sntg1 UTSW 1 8,748,074 (GRCm39) critical splice acceptor site probably null
R8986:Sntg1 UTSW 1 8,484,491 (GRCm39) missense possibly damaging 0.92
R9184:Sntg1 UTSW 1 8,748,056 (GRCm39) missense probably damaging 1.00
R9435:Sntg1 UTSW 1 8,433,814 (GRCm39) missense probably damaging 0.98
R9463:Sntg1 UTSW 1 8,624,974 (GRCm39) missense probably damaging 0.98
R9603:Sntg1 UTSW 1 8,748,198 (GRCm39) missense probably damaging 1.00
R9653:Sntg1 UTSW 1 8,433,749 (GRCm39) missense unknown
X0026:Sntg1 UTSW 1 8,484,471 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CCACTTCTTATGTGTTCAGCAAAGCAG -3'
(R):5'- GGCACCCTTTAGTGTAACATAGCCTAC -3'

Sequencing Primer
(F):5'- GAGAATCAGATGGCACCAAGATT -3'
(R):5'- tctatctgcctcctctgcc -3'
Posted On 2013-06-11