Mutagenetix > Incidental Mutation

Incidental Mutation 'R0551:Sntg1'

45133

Institutional Source

Beutler Lab

Gene Symbol

Sntg1

Ensembl Gene

ENSMUSG00000025909

Gene Name

syntrophin, gamma 1

Synonyms

SYN4, G1SYN

MMRRC Submission

038743-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.113) question?

Stock #

R0551 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8361475-9299878 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 8554736 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 279 (V279L)

Ref Sequence

ENSEMBL: ENSMUSP00000141839 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115488] [ENSMUST00000132064] [ENSMUST00000140295] [ENSMUST00000140302] [ENSMUST00000191683]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115488
AA Change: V280L

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000111151
Gene: ENSMUSG00000025909
AA Change: V280L

Domain	Start	End	E-Value	Type
Blast:Tubulin_C	6	54	3e-20	BLAST
PDZ	66	140	3.41e-17	SMART
PH	180	266	8.91e0	SMART
PH	284	392	7.66e-1	SMART
low complexity region	440	449	N/A	INTRINSIC
low complexity region	499	514	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000132064
AA Change: V279L

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000122134
Gene: ENSMUSG00000025909
AA Change: V279L

Domain	Start	End	E-Value	Type
Blast:Tubulin_C	6	54	3e-20	BLAST
PDZ	66	139	1.84e-13	SMART
PH	179	265	8.91e0	SMART
PH	283	391	7.66e-1	SMART
low complexity region	439	448	N/A	INTRINSIC
low complexity region	498	513	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000140295
AA Change: V280L

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000118101
Gene: ENSMUSG00000025909
AA Change: V280L

Domain	Start	End	E-Value	Type
Blast:Tubulin_C	17	65	3e-20	BLAST
PDZ	77	150	1.84e-13	SMART
PH	190	276	8.91e0	SMART
PH	294	402	7.66e-1	SMART
low complexity region	450	459	N/A	INTRINSIC
low complexity region	509	524	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140302

SMART Domains

Protein: ENSMUSP00000117397
Gene: ENSMUSG00000025909

Domain	Start	End	E-Value	Type
PDZ	66	140	3.41e-17	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000191683
AA Change: V279L

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000141839
Gene: ENSMUSG00000025909
AA Change: V279L

Domain	Start	End	E-Value	Type
Blast:Tubulin_C	6	54	3e-20	BLAST
PDZ	66	139	1.84e-13	SMART
PH	179	265	8.91e0	SMART
PH	283	391	7.66e-1	SMART
low complexity region	439	448	N/A	INTRINSIC
low complexity region	498	513	N/A	INTRINSIC

Meta Mutation Damage Score

0.0806

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 95.1%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the syntrophin family. Syntrophins are cytoplasmic peripheral membrane proteins that typically contain 2 pleckstrin homology (PH) domains, a PDZ domain that bisects the first PH domain, and a C-terminal domain that mediates dystrophin binding. This family member plays a role in mediating gamma-enolase trafficking to the plasma membrane and in enhancing its neurotrophic activity. Mutations in this gene are associated with idiopathic scoliosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2016]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	T	A	14: 32,662,641	T456S	probably benign	Het
5830473C10Rik	C	T	5: 90,572,719	P250S	probably damaging	Het
Acmsd	A	T	1: 127,766,333	K333N	probably benign	Het
Adcy2	T	A	13: 68,796,539	K241N	probably damaging	Het
Aebp1	A	G	11: 5,867,955	I77V	probably benign	Het
Ankrd35	A	G	3: 96,683,960	T521A	probably benign	Het
Arap2	C	T	5: 62,641,323		probably null	Het
Arfgap3	A	T	15: 83,343,137	C25S	probably damaging	Het
Arhgap20	T	A	9: 51,825,825		probably benign	Het
Arhgap39	C	T	15: 76,734,886	D833N	probably damaging	Het
Auts2	T	C	5: 131,440,469	E446G	possibly damaging	Het
Brwd1	C	T	16: 96,035,974	R886H	probably damaging	Het
Carm1	G	A	9: 21,580,491		probably null	Het
Cdc5l	G	A	17: 45,415,684	R321W	probably damaging	Het
Cfap54	A	T	10: 93,025,122	M841K	probably benign	Het
Clca4b	T	A	3: 144,928,626	T69S	probably damaging	Het
Cpox	A	G	16: 58,675,390	I357V	probably benign	Het
Diaph3	C	A	14: 86,910,100	V711L	probably benign	Het
Fabp3-ps1	T	C	10: 86,732,040		probably benign	Het
Fam120b	A	T	17: 15,431,643		probably benign	Het
Fcho1	A	G	8: 71,712,174	S488P	probably benign	Het
Flcn	A	G	11: 59,795,748		probably null	Het
Flt3l	A	G	7: 45,132,266	W234R	probably damaging	Het
Fzd7	G	T	1: 59,483,284	V109L	probably damaging	Het
G3bp1	A	G	11: 55,489,143	N101S	probably benign	Het
Gadd45g	A	G	13: 51,847,927	E143G	probably damaging	Het
Ganab	T	G	19: 8,907,280	I149S	probably benign	Het
Garnl3	A	G	2: 33,016,738	S413P	probably damaging	Het
Glis1	C	T	4: 107,568,119		probably null	Het
Gm11563	A	G	11: 99,658,713	S72P	unknown	Het
Gpd1	T	G	15: 99,720,629	I188S	possibly damaging	Het
Gria2	A	G	3: 80,732,026		probably benign	Het
H2afy2	A	G	10: 61,741,166	S308P	probably damaging	Het
Hpcal4	G	T	4: 123,189,055	A65S	possibly damaging	Het
Igsf10	G	A	3: 59,328,668	T1364I	probably benign	Het
Kdm4a	T	C	4: 118,138,231	*1065W	probably null	Het
Klkb1	A	G	8: 45,277,966		probably null	Het
Lipo3	T	C	19: 33,580,551	D147G	probably damaging	Het
Lrp1	A	G	10: 127,571,958	S1821P	probably benign	Het
Manba	T	C	3: 135,517,973	I207T	probably damaging	Het
Mark3	T	A	12: 111,633,634	S428T	probably benign	Het
Mfsd4a	G	A	1: 132,041,919	T348I	probably damaging	Het
Mfsd7a	A	G	5: 108,444,465		probably benign	Het
Mybbp1a	A	G	11: 72,448,376	M880V	probably benign	Het
N4bp2	T	A	5: 65,820,341		probably null	Het
Nrd1	T	G	4: 109,047,708	I712S	probably damaging	Het
Nup210	G	A	6: 91,021,484	R774C	possibly damaging	Het
Obscn	G	A	11: 59,107,862	R1395*	probably null	Het
Olfr1454	T	A	19: 13,064,294	D294E	probably benign	Het
Pcdh7	T	C	5: 57,721,994	Y964H	probably damaging	Het
Plin4	T	C	17: 56,106,756	T290A	probably benign	Het
Ppara	T	C	15: 85,787,105		probably benign	Het
Psg21	T	G	7: 18,652,640		probably null	Het
Ptar1	C	A	19: 23,720,340	N405K	probably benign	Het
Ralgps2	A	G	1: 156,832,663		probably null	Het
Rnf6	T	A	5: 146,211,395	N271I	possibly damaging	Het
Sis	T	C	3: 72,925,407	D1019G	possibly damaging	Het
Slc37a3	A	G	6: 39,352,754		probably benign	Het
Slc6a12	G	A	6: 121,356,918	V238I	probably damaging	Het
Sorbs1	T	A	19: 40,311,816	E567D	probably damaging	Het
Sp110	C	A	1: 85,589,100		probably benign	Het
Ssu2	A	G	6: 112,380,554	V175A	possibly damaging	Het
Stk36	G	A	1: 74,616,621	E428K	probably benign	Het
Teddm1b	A	T	1: 153,875,344	I300F	possibly damaging	Het
Thy1	T	C	9: 44,047,348	V129A	probably damaging	Het
Tiam2	T	A	17: 3,428,954	M654K	probably damaging	Het
Tmem69	T	C	4: 116,553,273	S167G	probably benign	Het
Tmem8	C	A	17: 26,120,602	Q605K	probably damaging	Het
Tmem81	C	G	1: 132,507,829	I124M	probably damaging	Het
Tspan10	A	G	11: 120,444,418	D118G	probably damaging	Het
Tspo2	A	G	17: 48,448,813		probably benign	Het
Ttn	G	A	2: 76,908,328	Q4002*	probably null	Het
Tyro3	G	A	2: 119,816,904	R834Q	probably damaging	Het
Ugt2b1	T	C	5: 86,926,084	K139E	probably benign	Het
Vmn1r9	A	T	6: 57,071,539	I200F	probably benign	Het

Other mutations in Sntg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00896:Sntg1	APN	1	8595410	critical splice donor site	probably null
IGL01536:Sntg1	APN	1	8583200	splice site	probably null
IGL01558:Sntg1	APN	1	8463388	splice site	probably benign
IGL01649:Sntg1	APN	1	8681969	splice site	probably benign
IGL02230:Sntg1	APN	1	8681971	critical splice donor site	probably null
IGL02252:Sntg1	APN	1	8414228	missense	probably benign	0.00
IGL02804:Sntg1	APN	1	8803958	utr 5 prime	probably benign
IGL03165:Sntg1	APN	1	8445104	missense	probably damaging	1.00
IGL03400:Sntg1	APN	1	8463414	missense	probably damaging	0.98
R0013:Sntg1	UTSW	1	8463462	missense	probably damaging	1.00
R0079:Sntg1	UTSW	1	8679062	splice site	probably benign
R0379:Sntg1	UTSW	1	8782824	missense	probably damaging	1.00
R1081:Sntg1	UTSW	1	8445119	missense	possibly damaging	0.92
R1645:Sntg1	UTSW	1	8803931	missense	probably benign	0.06
R2089:Sntg1	UTSW	1	8595539	missense	probably benign	0.04
R2091:Sntg1	UTSW	1	8595539	missense	probably benign	0.04
R2091:Sntg1	UTSW	1	8595539	missense	probably benign	0.04
R3951:Sntg1	UTSW	1	8782901	splice site	probably benign
R4152:Sntg1	UTSW	1	8583345	splice site	probably null
R4153:Sntg1	UTSW	1	8583345	splice site	probably null
R4154:Sntg1	UTSW	1	8583345	splice site	probably null
R4847:Sntg1	UTSW	1	8595482	missense	possibly damaging	0.93
R4888:Sntg1	UTSW	1	8363594	missense	probably damaging	0.98
R4947:Sntg1	UTSW	1	8782798	missense	probably damaging	1.00
R5065:Sntg1	UTSW	1	8363439	utr 3 prime	probably benign
R5293:Sntg1	UTSW	1	8595533	missense	probably damaging	1.00
R5550:Sntg1	UTSW	1	8624784	missense	probably damaging	1.00
R5558:Sntg1	UTSW	1	8414271	missense	possibly damaging	0.94
R5687:Sntg1	UTSW	1	8463443	missense	possibly damaging	0.94
R5759:Sntg1	UTSW	1	8414270	missense	probably benign	0.00
R6075:Sntg1	UTSW	1	8679114	makesense	probably null
R6266:Sntg1	UTSW	1	8554729	missense	possibly damaging	0.56
R6313:Sntg1	UTSW	1	8445024	splice site	probably null
R6345:Sntg1	UTSW	1	8583284	missense	possibly damaging	0.85
R6490:Sntg1	UTSW	1	8583284	missense	possibly damaging	0.85
R6571:Sntg1	UTSW	1	8363528	utr 3 prime	probably benign
R6736:Sntg1	UTSW	1	8445050	missense	probably benign	0.16
R7112:Sntg1	UTSW	1	8448065	missense	possibly damaging	0.93
R7266:Sntg1	UTSW	1	8682019	missense	possibly damaging	0.81
R7414:Sntg1	UTSW	1	8448065	missense	probably damaging	1.00
R7583:Sntg1	UTSW	1	8445025	critical splice donor site	probably null
R7892:Sntg1	UTSW	1	8782800	missense	probably damaging	1.00
R7961:Sntg1	UTSW	1	8363570	missense	probably damaging	0.96
R7968:Sntg1	UTSW	1	8465536	nonsense	probably null
R8009:Sntg1	UTSW	1	8363570	missense	probably damaging	0.96
R8888:Sntg1	UTSW	1	8677850	critical splice acceptor site	probably null
R8895:Sntg1	UTSW	1	8677850	critical splice acceptor site	probably null
R8986:Sntg1	UTSW	1	8414267	missense	possibly damaging	0.92
R9184:Sntg1	UTSW	1	8677832	missense	probably damaging	1.00
R9435:Sntg1	UTSW	1	8363590	missense	probably damaging	0.98
R9463:Sntg1	UTSW	1	8554750	missense	probably damaging	0.98
R9603:Sntg1	UTSW	1	8677974	missense	probably damaging	1.00
R9653:Sntg1	UTSW	1	8363525	missense	unknown
X0026:Sntg1	UTSW	1	8414247	missense	probably benign	0.40

Predicted Primers

PCR Primer
(F):5'- CCACTTCTTATGTGTTCAGCAAAGCAG -3'
(R):5'- GGCACCCTTTAGTGTAACATAGCCTAC -3'

Sequencing Primer
(F):5'- GAGAATCAGATGGCACCAAGATT -3'
(R):5'- tctatctgcctcctctgcc -3'

Posted On

2013-06-11