Incidental Mutation 'R5719:Abca4'
ID451335
Institutional Source Beutler Lab
Gene Symbol Abca4
Ensembl Gene ENSMUSG00000028125
Gene NameATP-binding cassette, sub-family A (ABC1), member 4
SynonymsD430003I15Rik, Abc10, Rim protein, RmP
MMRRC Submission 043339-MU
Accession Numbers

Genbank: NM_007378; MGI: 109424

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5719 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location122044443-122180123 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 122135266 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013995] [ENSMUST00000141135]
Predicted Effect probably null
Transcript: ENSMUST00000013995
SMART Domains Protein: ENSMUSP00000013995
Gene: ENSMUSG00000028125

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 608 856 5e-17 PFAM
AAA 955 1145 9.42e-13 SMART
transmembrane domain 1372 1394 N/A INTRINSIC
Pfam:ABC2_membrane_3 1522 1894 2.9e-44 PFAM
AAA 1963 2147 7.09e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000141135
SMART Domains Protein: ENSMUSP00000143560
Gene: ENSMUSG00000028125

DomainStartEndE-ValueType
Blast:AAA 1 172 9e-78 BLAST
Pfam:ABC2_membrane_3 311 686 1.9e-42 PFAM
AAA 755 939 1.2e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198484
Meta Mutation Damage Score 0.9475 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein was the first of the ABC transporters to be observed in photoreceptors and may play a role in the photoresponse. Mutations in the human gene are found in patients diagnosed with Stargardt disease and are associated with retinitis pigmentosa-19 and macular degeneration age-related 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display delayed rod dark adaptation and are a model for juvenile macular degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,273,245 H1137Q probably damaging Het
A130051J06Rik C T 15: 95,790,760 probably benign Het
A630001G21Rik T A 1: 85,723,385 R110W probably benign Het
Abcc3 T C 11: 94,351,068 N1379S probably damaging Het
Actrt3 A C 3: 30,598,127 F273V probably benign Het
Adam22 T C 5: 8,367,217 D75G probably benign Het
Armc4 G T 18: 7,211,496 Q793K probably benign Het
Ash1l C A 3: 89,054,498 D2392E possibly damaging Het
Ash1l T C 3: 89,058,626 I2445T probably damaging Het
Cacna2d2 A G 9: 107,524,652 I762V probably benign Het
Ccdc127 T A 13: 74,357,068 probably benign Het
Ccdc91 C G 6: 147,575,503 L230V unknown Het
Cdk13 A G 13: 17,719,655 I1129T probably damaging Het
Cnot1 C T 8: 95,744,296 R1308H possibly damaging Het
Crhr2 T C 6: 55,103,222 H144R probably damaging Het
Dnmt1 T C 9: 20,912,595 N993S possibly damaging Het
Eif4g1 T A 16: 20,689,011 V1182D probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam234a T A 17: 26,214,653 Q399L possibly damaging Het
Fyb A T 15: 6,580,869 K308* probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm10309 A T 17: 86,498,993 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm5501 G A 18: 9,917,417 noncoding transcript Het
Gm6309 A T 5: 146,168,182 V307D probably benign Het
Gm9871 T A 6: 101,796,187 noncoding transcript Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Herc3 T A 6: 58,894,543 V70E possibly damaging Het
Hes7 A G 11: 69,121,589 E41G probably damaging Het
Ifi27l2b T C 12: 103,455,787 D106G unknown Het
Igfbp6 A T 15: 102,148,181 Y184F probably damaging Het
Isyna1 A G 8: 70,594,702 Y25C probably damaging Het
Kcng3 G T 17: 83,631,134 T162K possibly damaging Het
Krt36 T C 11: 100,104,161 D195G possibly damaging Het
Lrwd1 A T 5: 136,132,239 probably null Het
Lsg1 C T 16: 30,561,775 A615T probably benign Het
Myo5a A T 9: 75,151,931 E480D probably damaging Het
Myrf T A 19: 10,216,723 D690V probably damaging Het
N4bp1 T C 8: 86,851,684 I684M probably damaging Het
Nlrc3 C T 16: 3,963,725 A607T probably damaging Het
Nuak1 A T 10: 84,409,720 I87N probably damaging Het
Olfr1131 T C 2: 87,629,131 probably null Het
Olfr490 T G 7: 108,286,392 T245P probably damaging Het
Olfr878 A T 9: 37,919,351 E236D probably damaging Het
Osbpl9 T A 4: 109,062,566 R689* probably null Het
Ppargc1b T A 18: 61,307,568 M744L probably benign Het
Prss40 A T 1: 34,552,517 probably benign Het
Ptprd T A 4: 76,054,602 probably null Het
Rft1 T C 14: 30,663,226 probably benign Het
Rftn2 C T 1: 55,214,286 V53I probably damaging Het
Rnaset2a T C 17: 8,132,047 Y167C probably damaging Het
Schip1 T C 3: 68,408,227 probably benign Het
Scn5a A C 9: 119,530,052 L643R possibly damaging Het
Shroom3 T A 5: 92,943,018 M1128K probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc14a2 A G 18: 78,209,042 L18P probably benign Het
Slc22a3 C T 17: 12,423,804 V509M probably damaging Het
Slc7a5 A C 8: 121,883,642 F478V probably benign Het
Smc1b T A 15: 85,096,658 N803I probably benign Het
Snf8 T A 11: 96,041,725 N115K probably damaging Het
Stox2 T A 8: 47,413,137 K57* probably null Het
Tmem248 T A 5: 130,229,588 F41I probably damaging Het
Tmprss7 T C 16: 45,686,430 S90G probably damaging Het
Top3b T C 16: 16,885,836 V285A probably damaging Het
Tsen15 T C 1: 152,371,783 T153A probably damaging Het
Usp34 T G 11: 23,354,846 S360A probably benign Het
Wdr24 T C 17: 25,828,340 probably null Het
Zbtb2 G A 10: 4,369,456 T190I probably benign Het
Zranb3 T C 1: 127,963,876 S788G probably benign Het
Other mutations in Abca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Abca4 APN 3 122062704 splice site probably null
IGL00229:Abca4 APN 3 122170954 missense probably damaging 1.00
IGL00858:Abca4 APN 3 122173888 missense probably damaging 0.97
IGL01316:Abca4 APN 3 122141755 missense probably damaging 0.99
IGL01357:Abca4 APN 3 122103583 missense probably damaging 1.00
IGL01784:Abca4 APN 3 122138505 missense probably benign 0.22
IGL01903:Abca4 APN 3 122155401 splice site probably benign
IGL02008:Abca4 APN 3 122176101 missense probably benign 0.00
IGL02113:Abca4 APN 3 122110478 missense possibly damaging 0.90
IGL02142:Abca4 APN 3 122169926 missense probably benign 0.01
IGL02200:Abca4 APN 3 122069014 missense probably benign 0.00
IGL02203:Abca4 APN 3 122179808 missense probably benign
IGL02306:Abca4 APN 3 122158395 missense probably damaging 1.00
IGL02307:Abca4 APN 3 122141746 missense probably damaging 1.00
IGL02673:Abca4 APN 3 122103501 missense probably damaging 1.00
IGL02864:Abca4 APN 3 122143431 missense probably damaging 1.00
IGL02886:Abca4 APN 3 122128214 missense probably damaging 0.96
IGL02934:Abca4 APN 3 122162359 nonsense probably null
IGL02992:Abca4 APN 3 122128286 missense probably damaging 0.96
IGL03083:Abca4 APN 3 122138612 critical splice donor site probably null
IGL03258:Abca4 APN 3 122137561 splice site probably benign
IGL03279:Abca4 APN 3 122141732 missense probably benign 0.12
3-1:Abca4 UTSW 3 122080925 missense probably benign 0.01
B6819:Abca4 UTSW 3 122103624 splice site probably benign
K7894:Abca4 UTSW 3 122147868 frame shift probably null
PIT4151001:Abca4 UTSW 3 122137021 missense probably damaging 0.99
PIT4453001:Abca4 UTSW 3 122105316 missense probably damaging 0.99
R0001:Abca4 UTSW 3 122081011 splice site probably benign
R0091:Abca4 UTSW 3 122138530 missense possibly damaging 0.94
R0138:Abca4 UTSW 3 122105449 missense probably damaging 1.00
R0344:Abca4 UTSW 3 122083964 missense probably damaging 1.00
R0347:Abca4 UTSW 3 122120099 missense probably benign 0.00
R0508:Abca4 UTSW 3 122123551 splice site probably benign
R0607:Abca4 UTSW 3 122156432 missense probably damaging 1.00
R0835:Abca4 UTSW 3 122126213 missense probably damaging 1.00
R0839:Abca4 UTSW 3 122126878 missense probably damaging 0.99
R1138:Abca4 UTSW 3 122173848 missense probably benign 0.13
R1448:Abca4 UTSW 3 122162928 splice site probably null
R1453:Abca4 UTSW 3 122069114 missense probably benign 0.04
R1533:Abca4 UTSW 3 122135158 missense probably benign 0.07
R1645:Abca4 UTSW 3 122155277 missense probably benign 0.00
R1763:Abca4 UTSW 3 122110681 missense probably benign 0.09
R1763:Abca4 UTSW 3 122163830 missense probably damaging 1.00
R1838:Abca4 UTSW 3 122128305 missense probably benign
R1867:Abca4 UTSW 3 122105361 missense probably damaging 1.00
R1907:Abca4 UTSW 3 122069012 missense probably damaging 0.99
R1935:Abca4 UTSW 3 122052923 missense probably benign 0.00
R1936:Abca4 UTSW 3 122052923 missense probably benign 0.00
R2165:Abca4 UTSW 3 122112399 missense possibly damaging 0.90
R2391:Abca4 UTSW 3 122158422 missense probably benign 0.00
R2403:Abca4 UTSW 3 122170943 missense probably damaging 1.00
R3788:Abca4 UTSW 3 122052912 missense possibly damaging 0.50
R3814:Abca4 UTSW 3 122170921 splice site probably benign
R4554:Abca4 UTSW 3 122156343 missense possibly damaging 0.91
R4649:Abca4 UTSW 3 122169893 missense probably damaging 1.00
R4653:Abca4 UTSW 3 122138581 nonsense probably null
R4655:Abca4 UTSW 3 122147498 missense possibly damaging 0.93
R4668:Abca4 UTSW 3 122155299 missense possibly damaging 0.90
R4705:Abca4 UTSW 3 122105370 missense probably damaging 0.98
R4788:Abca4 UTSW 3 122166712 missense probably damaging 1.00
R4795:Abca4 UTSW 3 122176123 missense probably damaging 0.99
R4999:Abca4 UTSW 3 122105370 missense probably damaging 1.00
R5301:Abca4 UTSW 3 122102853 missense probably damaging 0.96
R5372:Abca4 UTSW 3 122055339 missense probably damaging 0.96
R5395:Abca4 UTSW 3 122080941 missense probably benign 0.00
R5539:Abca4 UTSW 3 122169908 missense probably damaging 1.00
R5583:Abca4 UTSW 3 122148901 missense probably damaging 0.99
R5706:Abca4 UTSW 3 122054261 missense probably benign 0.10
R5731:Abca4 UTSW 3 122132593 missense probably damaging 1.00
R5802:Abca4 UTSW 3 122054232 missense probably damaging 1.00
R5819:Abca4 UTSW 3 122136981 missense probably damaging 0.97
R5853:Abca4 UTSW 3 122103531 missense probably benign
R6053:Abca4 UTSW 3 122171017 missense probably damaging 0.99
R6135:Abca4 UTSW 3 122138447 missense possibly damaging 0.69
R6185:Abca4 UTSW 3 122126140 missense probably damaging 0.97
R6227:Abca4 UTSW 3 122137094 nonsense probably null
R6293:Abca4 UTSW 3 122141746 missense probably damaging 1.00
R6297:Abca4 UTSW 3 122132530 missense probably benign 0.24
R6367:Abca4 UTSW 3 122103580 missense probably damaging 1.00
R6376:Abca4 UTSW 3 122123660 missense possibly damaging 0.95
R6405:Abca4 UTSW 3 122173662 intron probably null
R6525:Abca4 UTSW 3 122137659 missense probably benign 0.00
R6602:Abca4 UTSW 3 122138501 missense probably benign 0.00
R6681:Abca4 UTSW 3 122121798 missense probably damaging 1.00
R6747:Abca4 UTSW 3 122126313 intron probably null
R6852:Abca4 UTSW 3 122135195 missense probably damaging 0.99
R7049:Abca4 UTSW 3 122147848 missense probably benign 0.00
R7072:Abca4 UTSW 3 122173943 missense probably damaging 1.00
R7092:Abca4 UTSW 3 122138569 missense probably damaging 1.00
R7110:Abca4 UTSW 3 122132643 missense probably damaging 1.00
R7138:Abca4 UTSW 3 122105464 nonsense probably null
R7172:Abca4 UTSW 3 122103540 nonsense probably null
R7263:Abca4 UTSW 3 122054194 missense probably damaging 0.99
R7414:Abca4 UTSW 3 122102738 missense probably benign 0.28
R7537:Abca4 UTSW 3 122173988 missense possibly damaging 0.68
R7577:Abca4 UTSW 3 122174014 missense probably damaging 1.00
R7665:Abca4 UTSW 3 122044490 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTCCCCAGGACAAGTGGATC -3'
(R):5'- GAAGTGTCTGATCTCCCCAACC -3'

Sequencing Primer
(F):5'- GACAAGTGGATCCTCCCAAGG -3'
(R):5'- TGGAAAGTCAGGATCAGTACCACAC -3'
Posted On2017-01-03