Incidental Mutation 'R5719:Crhr2'
ID451344
Institutional Source Beutler Lab
Gene Symbol Crhr2
Ensembl Gene ENSMUSG00000003476
Gene Namecorticotropin releasing hormone receptor 2
SynonymsCRF-R2, CRH-R2, Crfr2, CRF 2 receptor, CRFR2beta, CRFR2alpha
MMRRC Submission 043339-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R5719 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location55090049-55133016 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55103222 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 144 (H144R)
Ref Sequence ENSEMBL: ENSMUSP00000148408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003568] [ENSMUST00000095898] [ENSMUST00000114374] [ENSMUST00000164012] [ENSMUST00000212633] [ENSMUST00000213026]
Predicted Effect probably damaging
Transcript: ENSMUST00000003568
AA Change: H143R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003568
Gene: ENSMUSG00000003476
AA Change: H143R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
HormR 56 127 3.55e-28 SMART
Pfam:7tm_2 132 374 8.4e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095898
SMART Domains Protein: ENSMUSP00000093586
Gene: ENSMUSG00000003476

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
HormR 36 107 1.75e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114374
AA Change: H123R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110015
Gene: ENSMUSG00000003476
AA Change: H123R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
HormR 36 107 3.55e-28 SMART
Pfam:7tm_2 112 354 9.7e-80 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164012
AA Change: H144R

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126673
Gene: ENSMUSG00000003476
AA Change: H144R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
HormR 56 127 3.55e-28 SMART
Pfam:7tm_2 132 374 1e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204117
Predicted Effect probably damaging
Transcript: ENSMUST00000212633
AA Change: H144R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000213026
AA Change: H124R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.4257 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the G-protein coupled receptor 2 family, and the subfamily of corticotropin releasing hormone receptor. This receptor shows high affinity for corticotropin releasing hormone (CRH), and also binds CRH-related peptides such as urocortin. CRH is synthesized in the hypothalamus, and plays an important role in coordinating the endocrine, autonomic, and behavioral responses to stress and immune challenge. Studies in mice suggest that this receptor maybe involved in mediating cardiovascular homeostasis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous inactivation of this gene may result in hypersensitivity to stress, increased anxiety-like behavior, abnormal homeostatic responses to challenges of increased dietary fat and cold, and cardiovascular abnormalities, including hypertension and decreased cardiac contractility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,273,245 H1137Q probably damaging Het
A130051J06Rik C T 15: 95,790,760 probably benign Het
A630001G21Rik T A 1: 85,723,385 R110W probably benign Het
Abca4 T C 3: 122,135,266 probably null Het
Abcc3 T C 11: 94,351,068 N1379S probably damaging Het
Actrt3 A C 3: 30,598,127 F273V probably benign Het
Adam22 T C 5: 8,367,217 D75G probably benign Het
Armc4 G T 18: 7,211,496 Q793K probably benign Het
Ash1l C A 3: 89,054,498 D2392E possibly damaging Het
Ash1l T C 3: 89,058,626 I2445T probably damaging Het
Cacna2d2 A G 9: 107,524,652 I762V probably benign Het
Ccdc127 T A 13: 74,357,068 probably benign Het
Ccdc91 C G 6: 147,575,503 L230V unknown Het
Cdk13 A G 13: 17,719,655 I1129T probably damaging Het
Cnot1 C T 8: 95,744,296 R1308H possibly damaging Het
Dnmt1 T C 9: 20,912,595 N993S possibly damaging Het
Eif4g1 T A 16: 20,689,011 V1182D probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam234a T A 17: 26,214,653 Q399L possibly damaging Het
Fyb A T 15: 6,580,869 K308* probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm10309 A T 17: 86,498,993 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm5501 G A 18: 9,917,417 noncoding transcript Het
Gm6309 A T 5: 146,168,182 V307D probably benign Het
Gm9871 T A 6: 101,796,187 noncoding transcript Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Herc3 T A 6: 58,894,543 V70E possibly damaging Het
Hes7 A G 11: 69,121,589 E41G probably damaging Het
Ifi27l2b T C 12: 103,455,787 D106G unknown Het
Igfbp6 A T 15: 102,148,181 Y184F probably damaging Het
Isyna1 A G 8: 70,594,702 Y25C probably damaging Het
Kcng3 G T 17: 83,631,134 T162K possibly damaging Het
Krt36 T C 11: 100,104,161 D195G possibly damaging Het
Lrwd1 A T 5: 136,132,239 probably null Het
Lsg1 C T 16: 30,561,775 A615T probably benign Het
Myo5a A T 9: 75,151,931 E480D probably damaging Het
Myrf T A 19: 10,216,723 D690V probably damaging Het
N4bp1 T C 8: 86,851,684 I684M probably damaging Het
Nlrc3 C T 16: 3,963,725 A607T probably damaging Het
Nuak1 A T 10: 84,409,720 I87N probably damaging Het
Olfr1131 T C 2: 87,629,131 probably null Het
Olfr490 T G 7: 108,286,392 T245P probably damaging Het
Olfr878 A T 9: 37,919,351 E236D probably damaging Het
Osbpl9 T A 4: 109,062,566 R689* probably null Het
Ppargc1b T A 18: 61,307,568 M744L probably benign Het
Prss40 A T 1: 34,552,517 probably benign Het
Ptprd T A 4: 76,054,602 probably null Het
Rft1 T C 14: 30,663,226 probably benign Het
Rftn2 C T 1: 55,214,286 V53I probably damaging Het
Rnaset2a T C 17: 8,132,047 Y167C probably damaging Het
Schip1 T C 3: 68,408,227 probably benign Het
Scn5a A C 9: 119,530,052 L643R possibly damaging Het
Shroom3 T A 5: 92,943,018 M1128K probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc14a2 A G 18: 78,209,042 L18P probably benign Het
Slc22a3 C T 17: 12,423,804 V509M probably damaging Het
Slc7a5 A C 8: 121,883,642 F478V probably benign Het
Smc1b T A 15: 85,096,658 N803I probably benign Het
Snf8 T A 11: 96,041,725 N115K probably damaging Het
Stox2 T A 8: 47,413,137 K57* probably null Het
Tmem248 T A 5: 130,229,588 F41I probably damaging Het
Tmprss7 T C 16: 45,686,430 S90G probably damaging Het
Top3b T C 16: 16,885,836 V285A probably damaging Het
Tsen15 T C 1: 152,371,783 T153A probably damaging Het
Usp34 T G 11: 23,354,846 S360A probably benign Het
Wdr24 T C 17: 25,828,340 probably null Het
Zbtb2 G A 10: 4,369,456 T190I probably benign Het
Zranb3 T C 1: 127,963,876 S788G probably benign Het
Other mutations in Crhr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02173:Crhr2 APN 6 55103180 missense probably damaging 1.00
R0278:Crhr2 UTSW 6 55117531 missense probably benign 0.16
R1056:Crhr2 UTSW 6 55100735 missense probably damaging 1.00
R1701:Crhr2 UTSW 6 55099270 missense probably damaging 1.00
R1702:Crhr2 UTSW 6 55092535 missense probably damaging 1.00
R2697:Crhr2 UTSW 6 55102830 missense probably damaging 1.00
R4020:Crhr2 UTSW 6 55100780 splice site probably benign
R4030:Crhr2 UTSW 6 55117677 missense probably benign 0.34
R4527:Crhr2 UTSW 6 55132853 utr 5 prime probably benign
R4698:Crhr2 UTSW 6 55102867 missense possibly damaging 0.90
R4737:Crhr2 UTSW 6 55091305 missense probably damaging 1.00
R5437:Crhr2 UTSW 6 55100733 missense probably damaging 1.00
R5718:Crhr2 UTSW 6 55092100 nonsense probably null
R5945:Crhr2 UTSW 6 55100682 missense possibly damaging 0.93
R6046:Crhr2 UTSW 6 55091292 missense probably damaging 1.00
R6358:Crhr2 UTSW 6 55093043 missense probably benign 0.20
R6826:Crhr2 UTSW 6 55117740 intron probably benign
R7011:Crhr2 UTSW 6 55099210 critical splice donor site probably null
R7131:Crhr2 UTSW 6 55092127 missense
R7820:Crhr2 UTSW 6 55102779 missense probably damaging 0.97
Z1088:Crhr2 UTSW 6 55103216 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CTGAACCAGAGCCTAAGGAC -3'
(R):5'- GAAGATCTAGGTGCCTGAGGATAC -3'

Sequencing Primer
(F):5'- TCTACCCTTCAGGCAGGCTG -3'
(R):5'- ACATAGCCATGCCTCTGT -3'
Posted On2017-01-03