Incidental Mutation 'R5719:Olfr490'
ID451348
Institutional Source Beutler Lab
Gene Symbol Olfr490
Ensembl Gene ENSMUSG00000109884
Gene Nameolfactory receptor 490
SynonymsMOR204-17, GA_x6K02T2PBJ9-10617173-10616229
MMRRC Submission 043339-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R5719 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108285893-108288934 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 108286392 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 245 (T245P)
Ref Sequence ENSEMBL: ENSMUSP00000147922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000210114] [ENSMUST00000211345]
Predicted Effect probably damaging
Transcript: ENSMUST00000074550
AA Change: T245P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074137
Gene: ENSMUSG00000093808
AA Change: T245P

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 4e-53 PFAM
Pfam:7tm_1 44 293 5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210114
AA Change: T245P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000211345
AA Change: T245P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
Meta Mutation Damage Score 0.5269 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,273,245 H1137Q probably damaging Het
A130051J06Rik C T 15: 95,790,760 probably benign Het
A630001G21Rik T A 1: 85,723,385 R110W probably benign Het
Abca4 T C 3: 122,135,266 probably null Het
Abcc3 T C 11: 94,351,068 N1379S probably damaging Het
Actrt3 A C 3: 30,598,127 F273V probably benign Het
Adam22 T C 5: 8,367,217 D75G probably benign Het
Armc4 G T 18: 7,211,496 Q793K probably benign Het
Ash1l C A 3: 89,054,498 D2392E possibly damaging Het
Ash1l T C 3: 89,058,626 I2445T probably damaging Het
Cacna2d2 A G 9: 107,524,652 I762V probably benign Het
Ccdc127 T A 13: 74,357,068 probably benign Het
Ccdc91 C G 6: 147,575,503 L230V unknown Het
Cdk13 A G 13: 17,719,655 I1129T probably damaging Het
Cnot1 C T 8: 95,744,296 R1308H possibly damaging Het
Crhr2 T C 6: 55,103,222 H144R probably damaging Het
Dnmt1 T C 9: 20,912,595 N993S possibly damaging Het
Eif4g1 T A 16: 20,689,011 V1182D probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam234a T A 17: 26,214,653 Q399L possibly damaging Het
Fyb A T 15: 6,580,869 K308* probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm10309 A T 17: 86,498,993 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm5501 G A 18: 9,917,417 noncoding transcript Het
Gm6309 A T 5: 146,168,182 V307D probably benign Het
Gm9871 T A 6: 101,796,187 noncoding transcript Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Herc3 T A 6: 58,894,543 V70E possibly damaging Het
Hes7 A G 11: 69,121,589 E41G probably damaging Het
Ifi27l2b T C 12: 103,455,787 D106G unknown Het
Igfbp6 A T 15: 102,148,181 Y184F probably damaging Het
Isyna1 A G 8: 70,594,702 Y25C probably damaging Het
Kcng3 G T 17: 83,631,134 T162K possibly damaging Het
Krt36 T C 11: 100,104,161 D195G possibly damaging Het
Lrwd1 A T 5: 136,132,239 probably null Het
Lsg1 C T 16: 30,561,775 A615T probably benign Het
Myo5a A T 9: 75,151,931 E480D probably damaging Het
Myrf T A 19: 10,216,723 D690V probably damaging Het
N4bp1 T C 8: 86,851,684 I684M probably damaging Het
Nlrc3 C T 16: 3,963,725 A607T probably damaging Het
Nuak1 A T 10: 84,409,720 I87N probably damaging Het
Olfr1131 T C 2: 87,629,131 probably null Het
Olfr878 A T 9: 37,919,351 E236D probably damaging Het
Osbpl9 T A 4: 109,062,566 R689* probably null Het
Ppargc1b T A 18: 61,307,568 M744L probably benign Het
Prss40 A T 1: 34,552,517 probably benign Het
Ptprd T A 4: 76,054,602 probably null Het
Rft1 T C 14: 30,663,226 probably benign Het
Rftn2 C T 1: 55,214,286 V53I probably damaging Het
Rnaset2a T C 17: 8,132,047 Y167C probably damaging Het
Schip1 T C 3: 68,408,227 probably benign Het
Scn5a A C 9: 119,530,052 L643R possibly damaging Het
Shroom3 T A 5: 92,943,018 M1128K probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc14a2 A G 18: 78,209,042 L18P probably benign Het
Slc22a3 C T 17: 12,423,804 V509M probably damaging Het
Slc7a5 A C 8: 121,883,642 F478V probably benign Het
Smc1b T A 15: 85,096,658 N803I probably benign Het
Snf8 T A 11: 96,041,725 N115K probably damaging Het
Stox2 T A 8: 47,413,137 K57* probably null Het
Tmem248 T A 5: 130,229,588 F41I probably damaging Het
Tmprss7 T C 16: 45,686,430 S90G probably damaging Het
Top3b T C 16: 16,885,836 V285A probably damaging Het
Tsen15 T C 1: 152,371,783 T153A probably damaging Het
Usp34 T G 11: 23,354,846 S360A probably benign Het
Wdr24 T C 17: 25,828,340 probably null Het
Zbtb2 G A 10: 4,369,456 T190I probably benign Het
Zranb3 T C 1: 127,963,876 S788G probably benign Het
Other mutations in Olfr490
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0395:Olfr490 UTSW 7 108286271 missense probably benign 0.00
R0634:Olfr490 UTSW 7 108286296 missense probably benign 0.00
R0940:Olfr490 UTSW 7 108287057 missense probably benign 0.01
R1990:Olfr490 UTSW 7 108286359 nonsense probably null
R1991:Olfr490 UTSW 7 108286359 nonsense probably null
R2860:Olfr490 UTSW 7 108286962 missense probably damaging 0.98
R2861:Olfr490 UTSW 7 108286962 missense probably damaging 0.98
R3712:Olfr490 UTSW 7 108286456 nonsense probably null
R4735:Olfr490 UTSW 7 108286313 missense probably benign
R4895:Olfr490 UTSW 7 108286595 missense probably damaging 0.97
R4976:Olfr490 UTSW 7 108286611 missense probably damaging 1.00
R5686:Olfr490 UTSW 7 108286742 missense probably damaging 1.00
R5883:Olfr490 UTSW 7 108286244 missense probably damaging 1.00
R5911:Olfr490 UTSW 7 108286398 missense probably damaging 1.00
R6452:Olfr490 UTSW 7 108286893 missense probably damaging 1.00
R7018:Olfr490 UTSW 7 108286344 missense probably benign 0.34
R7233:Olfr490 UTSW 7 108286716 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TCAAAATGTCTTTTCAGGGCACC -3'
(R):5'- TCCTACATTGCTGGGTTTCTTAATG -3'

Sequencing Primer
(F):5'- ACCCTTAATCTCATTATTCCTAAGGC -3'
(R):5'- ACATTGCTGGGTTTCTTAATGCTTCC -3'
Posted On2017-01-03