Incidental Mutation 'R0551:Stk36'
ID 45136
Institutional Source Beutler Lab
Gene Symbol Stk36
Ensembl Gene ENSMUSG00000033276
Gene Name serine/threonine kinase 36
Synonyms 1700112N14Rik, Fused
MMRRC Submission 038743-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0551 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 74640604-74676053 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 74655780 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 428 (E428K)
Ref Sequence ENSEMBL: ENSMUSP00000084433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087183] [ENSMUST00000087186] [ENSMUST00000148456]
AlphaFold Q69ZM6
Predicted Effect probably benign
Transcript: ENSMUST00000087183
AA Change: E428K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000084430
Gene: ENSMUSG00000033276
AA Change: E428K

DomainStartEndE-ValueType
S_TKc 4 254 5.24e-100 SMART
low complexity region 405 419 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
low complexity region 705 718 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 852 860 N/A INTRINSIC
low complexity region 900 914 N/A INTRINSIC
low complexity region 956 969 N/A INTRINSIC
low complexity region 994 1009 N/A INTRINSIC
low complexity region 1014 1030 N/A INTRINSIC
Pfam:HEAT_2 1112 1218 7.8e-11 PFAM
Pfam:HEAT_2 1158 1259 3e-11 PFAM
Pfam:HEAT_EZ 1207 1261 4.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087186
AA Change: E428K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000084433
Gene: ENSMUSG00000033276
AA Change: E428K

DomainStartEndE-ValueType
S_TKc 4 254 5.24e-100 SMART
low complexity region 405 419 N/A INTRINSIC
low complexity region 577 590 N/A INTRINSIC
low complexity region 698 708 N/A INTRINSIC
low complexity region 724 732 N/A INTRINSIC
low complexity region 772 786 N/A INTRINSIC
low complexity region 828 841 N/A INTRINSIC
low complexity region 866 881 N/A INTRINSIC
low complexity region 886 902 N/A INTRINSIC
Pfam:HEAT_2 984 1090 2.9e-10 PFAM
Pfam:HEAT_2 1026 1131 9.6e-11 PFAM
Pfam:HEAT_EZ 1039 1092 2.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145673
Predicted Effect probably benign
Transcript: ENSMUST00000148456
AA Change: E428K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000120020
Gene: ENSMUSG00000033276
AA Change: E428K

DomainStartEndE-ValueType
S_TKc 4 254 5.24e-100 SMART
low complexity region 405 419 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
low complexity region 705 718 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 852 860 N/A INTRINSIC
low complexity region 898 912 N/A INTRINSIC
low complexity region 954 967 N/A INTRINSIC
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1012 1028 N/A INTRINSIC
Meta Mutation Damage Score 0.0893 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine kinase family of enzymes. This family member is similar to a Drosophila protein that plays a key role in the Hedgehog signaling pathway. This human protein is a positive regulator of the GLI zinc-finger transcription factors. Knockout studies of the homologous mouse gene suggest that defects in this human gene may lead to congenital hydrocephalus, possibly due to a functional defect in motile cilia. Because Hedgehog signaling is frequently activated in certain kinds of gastrointestinal cancers, it has been suggested that this gene is a target for the treatment of these cancers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations cause postnatal growth defects and lethality. Homozygotes for a null allele show hydrocephaly, cranial defects, otitis media and sterility. Homozygotes for another null allele show additional defects in lung and renal development, thymus and spleen atrophy, rhinitis and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,384,598 (GRCm39) T456S probably benign Het
Acmsd A T 1: 127,694,070 (GRCm39) K333N probably benign Het
Adcy2 T A 13: 68,944,658 (GRCm39) K241N probably damaging Het
Aebp1 A G 11: 5,817,955 (GRCm39) I77V probably benign Het
Albfm1 C T 5: 90,720,578 (GRCm39) P250S probably damaging Het
Ankrd35 A G 3: 96,591,276 (GRCm39) T521A probably benign Het
Arap2 C T 5: 62,798,666 (GRCm39) probably null Het
Arfgap3 A T 15: 83,227,338 (GRCm39) C25S probably damaging Het
Arhgap20 T A 9: 51,737,125 (GRCm39) probably benign Het
Arhgap39 C T 15: 76,619,086 (GRCm39) D833N probably damaging Het
Auts2 T C 5: 131,469,307 (GRCm39) E446G possibly damaging Het
Brwd1 C T 16: 95,837,174 (GRCm39) R886H probably damaging Het
Carm1 G A 9: 21,491,787 (GRCm39) probably null Het
Cdc5l G A 17: 45,726,610 (GRCm39) R321W probably damaging Het
Cfap54 A T 10: 92,860,984 (GRCm39) M841K probably benign Het
Clca4b T A 3: 144,634,387 (GRCm39) T69S probably damaging Het
Cpox A G 16: 58,495,753 (GRCm39) I357V probably benign Het
Diaph3 C A 14: 87,147,536 (GRCm39) V711L probably benign Het
Fabp3-ps1 T C 10: 86,567,904 (GRCm39) probably benign Het
Fam120b A T 17: 15,651,905 (GRCm39) probably benign Het
Fcho1 A G 8: 72,164,818 (GRCm39) S488P probably benign Het
Flcn A G 11: 59,686,574 (GRCm39) probably null Het
Flt3l A G 7: 44,781,690 (GRCm39) W234R probably damaging Het
Fzd7 G T 1: 59,522,443 (GRCm39) V109L probably damaging Het
G3bp1 A G 11: 55,379,969 (GRCm39) N101S probably benign Het
Gadd45g A G 13: 52,001,963 (GRCm39) E143G probably damaging Het
Ganab T G 19: 8,884,644 (GRCm39) I149S probably benign Het
Garnl3 A G 2: 32,906,750 (GRCm39) S413P probably damaging Het
Glis1 C T 4: 107,425,316 (GRCm39) probably null Het
Gm11563 A G 11: 99,549,539 (GRCm39) S72P unknown Het
Gpd1 T G 15: 99,618,510 (GRCm39) I188S possibly damaging Het
Gria2 A G 3: 80,639,333 (GRCm39) probably benign Het
Hpcal4 G T 4: 123,082,848 (GRCm39) A65S possibly damaging Het
Igsf10 G A 3: 59,236,089 (GRCm39) T1364I probably benign Het
Kdm4a T C 4: 117,995,428 (GRCm39) *1065W probably null Het
Klkb1 A G 8: 45,731,003 (GRCm39) probably null Het
Lipo3 T C 19: 33,557,951 (GRCm39) D147G probably damaging Het
Lrp1 A G 10: 127,407,827 (GRCm39) S1821P probably benign Het
Macroh2a2 A G 10: 61,576,945 (GRCm39) S308P probably damaging Het
Manba T C 3: 135,223,734 (GRCm39) I207T probably damaging Het
Mark3 T A 12: 111,600,068 (GRCm39) S428T probably benign Het
Mfsd4a G A 1: 131,969,657 (GRCm39) T348I probably damaging Het
Mybbp1a A G 11: 72,339,202 (GRCm39) M880V probably benign Het
N4bp2 T A 5: 65,977,684 (GRCm39) probably null Het
Nrdc T G 4: 108,904,905 (GRCm39) I712S probably damaging Het
Nup210 G A 6: 90,998,466 (GRCm39) R774C possibly damaging Het
Obscn G A 11: 58,998,688 (GRCm39) R1395* probably null Het
Or5b102 T A 19: 13,041,658 (GRCm39) D294E probably benign Het
Pcdh7 T C 5: 57,879,336 (GRCm39) Y964H probably damaging Het
Pgap6 C A 17: 26,339,576 (GRCm39) Q605K probably damaging Het
Plin4 T C 17: 56,413,756 (GRCm39) T290A probably benign Het
Ppara T C 15: 85,671,306 (GRCm39) probably benign Het
Psg21 T G 7: 18,386,565 (GRCm39) probably null Het
Ptar1 C A 19: 23,697,704 (GRCm39) N405K probably benign Het
Ralgps2 A G 1: 156,660,233 (GRCm39) probably null Het
Rnf6 T A 5: 146,148,205 (GRCm39) N271I possibly damaging Het
Sis T C 3: 72,832,740 (GRCm39) D1019G possibly damaging Het
Slc37a3 A G 6: 39,329,688 (GRCm39) probably benign Het
Slc49a3 A G 5: 108,592,331 (GRCm39) probably benign Het
Slc6a12 G A 6: 121,333,877 (GRCm39) V238I probably damaging Het
Sntg1 C A 1: 8,624,960 (GRCm39) V279L possibly damaging Het
Sorbs1 T A 19: 40,300,260 (GRCm39) E567D probably damaging Het
Sp110 C A 1: 85,516,821 (GRCm39) probably benign Het
Ssu2 A G 6: 112,357,515 (GRCm39) V175A possibly damaging Het
Teddm1b A T 1: 153,751,090 (GRCm39) I300F possibly damaging Het
Thy1 T C 9: 43,958,645 (GRCm39) V129A probably damaging Het
Tiam2 T A 17: 3,479,229 (GRCm39) M654K probably damaging Het
Tmem69 T C 4: 116,410,470 (GRCm39) S167G probably benign Het
Tmem81 C G 1: 132,435,567 (GRCm39) I124M probably damaging Het
Tspan10 A G 11: 120,335,244 (GRCm39) D118G probably damaging Het
Tspo2 A G 17: 48,755,841 (GRCm39) probably benign Het
Ttn G A 2: 76,738,672 (GRCm39) Q4002* probably null Het
Tyro3 G A 2: 119,647,385 (GRCm39) R834Q probably damaging Het
Ugt2b1 T C 5: 87,073,943 (GRCm39) K139E probably benign Het
Vmn1r9 A T 6: 57,048,524 (GRCm39) I200F probably benign Het
Other mutations in Stk36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Stk36 APN 1 74,673,861 (GRCm39) missense possibly damaging 0.82
IGL00485:Stk36 APN 1 74,673,244 (GRCm39) missense probably benign
IGL00792:Stk36 APN 1 74,650,276 (GRCm39) missense probably benign 0.01
IGL00941:Stk36 APN 1 74,663,093 (GRCm39) missense possibly damaging 0.85
IGL01324:Stk36 APN 1 74,664,769 (GRCm39) missense possibly damaging 0.66
IGL01538:Stk36 APN 1 74,672,797 (GRCm39) missense probably benign 0.03
IGL02143:Stk36 APN 1 74,655,728 (GRCm39) splice site probably benign
IGL02223:Stk36 APN 1 74,662,496 (GRCm39) missense possibly damaging 0.84
IGL02371:Stk36 APN 1 74,661,414 (GRCm39) missense probably benign 0.13
IGL02618:Stk36 APN 1 74,670,834 (GRCm39) splice site probably benign
IGL02655:Stk36 APN 1 74,673,694 (GRCm39) missense probably damaging 1.00
IGL02993:Stk36 APN 1 74,661,446 (GRCm39) missense probably benign 0.05
IGL03125:Stk36 APN 1 74,662,472 (GRCm39) missense probably damaging 1.00
IGL03242:Stk36 APN 1 74,662,511 (GRCm39) missense possibly damaging 0.70
R0373:Stk36 UTSW 1 74,672,779 (GRCm39) missense probably damaging 0.99
R0377:Stk36 UTSW 1 74,651,889 (GRCm39) missense probably benign
R0464:Stk36 UTSW 1 74,650,331 (GRCm39) missense probably damaging 0.98
R0520:Stk36 UTSW 1 74,641,365 (GRCm39) unclassified probably benign
R1118:Stk36 UTSW 1 74,671,925 (GRCm39) missense probably benign 0.29
R1119:Stk36 UTSW 1 74,671,925 (GRCm39) missense probably benign 0.29
R1471:Stk36 UTSW 1 74,650,314 (GRCm39) missense probably benign 0.14
R1915:Stk36 UTSW 1 74,673,346 (GRCm39) missense probably benign 0.08
R2159:Stk36 UTSW 1 74,673,896 (GRCm39) missense probably benign 0.00
R2290:Stk36 UTSW 1 74,665,303 (GRCm39) splice site probably benign
R2897:Stk36 UTSW 1 74,671,984 (GRCm39) missense probably null
R2898:Stk36 UTSW 1 74,671,984 (GRCm39) missense probably null
R4032:Stk36 UTSW 1 74,665,207 (GRCm39) missense probably benign
R4353:Stk36 UTSW 1 74,671,966 (GRCm39) missense possibly damaging 0.53
R4683:Stk36 UTSW 1 74,673,344 (GRCm39) missense probably benign 0.22
R4753:Stk36 UTSW 1 74,665,255 (GRCm39) missense probably benign 0.05
R4891:Stk36 UTSW 1 74,642,415 (GRCm39) missense probably damaging 1.00
R5068:Stk36 UTSW 1 74,661,504 (GRCm39) missense probably benign 0.00
R5115:Stk36 UTSW 1 74,674,986 (GRCm39) missense probably damaging 1.00
R5266:Stk36 UTSW 1 74,650,317 (GRCm39) missense probably benign
R5412:Stk36 UTSW 1 74,644,615 (GRCm39) splice site probably null
R5533:Stk36 UTSW 1 74,665,750 (GRCm39) missense possibly damaging 0.65
R5782:Stk36 UTSW 1 74,644,584 (GRCm39) missense possibly damaging 0.81
R6149:Stk36 UTSW 1 74,673,388 (GRCm39) missense probably benign 0.00
R6208:Stk36 UTSW 1 74,650,591 (GRCm39) missense probably benign 0.03
R6497:Stk36 UTSW 1 74,642,391 (GRCm39) missense probably damaging 1.00
R6805:Stk36 UTSW 1 74,661,398 (GRCm39) missense probably benign
R7064:Stk36 UTSW 1 74,649,979 (GRCm39) missense probably damaging 1.00
R7102:Stk36 UTSW 1 74,661,382 (GRCm39) missense probably benign 0.10
R7393:Stk36 UTSW 1 74,650,352 (GRCm39) nonsense probably null
R7408:Stk36 UTSW 1 74,672,725 (GRCm39) missense probably damaging 1.00
R7471:Stk36 UTSW 1 74,673,479 (GRCm39) missense unknown
R7816:Stk36 UTSW 1 74,650,328 (GRCm39) nonsense probably null
R8017:Stk36 UTSW 1 74,651,925 (GRCm39) missense probably benign
R8019:Stk36 UTSW 1 74,651,925 (GRCm39) missense probably benign
R8104:Stk36 UTSW 1 74,665,756 (GRCm39) missense probably benign 0.26
R8381:Stk36 UTSW 1 74,672,333 (GRCm39) missense probably benign
R8526:Stk36 UTSW 1 74,673,703 (GRCm39) missense probably benign 0.00
R8681:Stk36 UTSW 1 74,661,392 (GRCm39) missense probably damaging 0.99
R9320:Stk36 UTSW 1 74,655,793 (GRCm39) missense possibly damaging 0.64
R9436:Stk36 UTSW 1 74,650,272 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGGAGAAGTGTCCCCACCAGAAC -3'
(R):5'- CTGGAAAAGAACAGCCCCTCTGTC -3'

Sequencing Primer
(F):5'- GACTTCCTACTTCCTAGTAGAGACAG -3'
(R):5'- GTCTCCTTACGGCGTGATG -3'
Posted On 2013-06-11