Incidental Mutation 'R5719:Nuak1'
ID451362
Institutional Source Beutler Lab
Gene Symbol Nuak1
Ensembl Gene ENSMUSG00000020032
Gene NameNUAK family, SNF1-like kinase, 1
Synonyms
MMRRC Submission 043339-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5719 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location84370905-84440597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84409720 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 87 (I87N)
Ref Sequence ENSEMBL: ENSMUSP00000020220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020220]
Predicted Effect probably damaging
Transcript: ENSMUST00000020220
AA Change: I87N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020220
Gene: ENSMUSG00000020032
AA Change: I87N

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
S_TKc 56 307 2.3e-105 SMART
low complexity region 475 490 N/A INTRINSIC
low complexity region 559 589 N/A INTRINSIC
Meta Mutation Damage Score 0.9021 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (79/81)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted disruption of this gene die perinatally displaying omphalocele with a failure in closure of the secondary body wall. No gross morphological defects are detected in brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,273,245 H1137Q probably damaging Het
A130051J06Rik C T 15: 95,790,760 probably benign Het
A630001G21Rik T A 1: 85,723,385 R110W probably benign Het
Abca4 T C 3: 122,135,266 probably null Het
Abcc3 T C 11: 94,351,068 N1379S probably damaging Het
Actrt3 A C 3: 30,598,127 F273V probably benign Het
Adam22 T C 5: 8,367,217 D75G probably benign Het
Armc4 G T 18: 7,211,496 Q793K probably benign Het
Ash1l C A 3: 89,054,498 D2392E possibly damaging Het
Ash1l T C 3: 89,058,626 I2445T probably damaging Het
Cacna2d2 A G 9: 107,524,652 I762V probably benign Het
Ccdc127 T A 13: 74,357,068 probably benign Het
Ccdc91 C G 6: 147,575,503 L230V unknown Het
Cdk13 A G 13: 17,719,655 I1129T probably damaging Het
Cnot1 C T 8: 95,744,296 R1308H possibly damaging Het
Crhr2 T C 6: 55,103,222 H144R probably damaging Het
Dnmt1 T C 9: 20,912,595 N993S possibly damaging Het
Eif4g1 T A 16: 20,689,011 V1182D probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam234a T A 17: 26,214,653 Q399L possibly damaging Het
Fyb A T 15: 6,580,869 K308* probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm10309 A T 17: 86,498,993 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm5501 G A 18: 9,917,417 noncoding transcript Het
Gm6309 A T 5: 146,168,182 V307D probably benign Het
Gm9871 T A 6: 101,796,187 noncoding transcript Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Herc3 T A 6: 58,894,543 V70E possibly damaging Het
Hes7 A G 11: 69,121,589 E41G probably damaging Het
Ifi27l2b T C 12: 103,455,787 D106G unknown Het
Igfbp6 A T 15: 102,148,181 Y184F probably damaging Het
Isyna1 A G 8: 70,594,702 Y25C probably damaging Het
Kcng3 G T 17: 83,631,134 T162K possibly damaging Het
Krt36 T C 11: 100,104,161 D195G possibly damaging Het
Lrwd1 A T 5: 136,132,239 probably null Het
Lsg1 C T 16: 30,561,775 A615T probably benign Het
Myo5a A T 9: 75,151,931 E480D probably damaging Het
Myrf T A 19: 10,216,723 D690V probably damaging Het
N4bp1 T C 8: 86,851,684 I684M probably damaging Het
Nlrc3 C T 16: 3,963,725 A607T probably damaging Het
Olfr1131 T C 2: 87,629,131 probably null Het
Olfr490 T G 7: 108,286,392 T245P probably damaging Het
Olfr878 A T 9: 37,919,351 E236D probably damaging Het
Osbpl9 T A 4: 109,062,566 R689* probably null Het
Ppargc1b T A 18: 61,307,568 M744L probably benign Het
Prss40 A T 1: 34,552,517 probably benign Het
Ptprd T A 4: 76,054,602 probably null Het
Rft1 T C 14: 30,663,226 probably benign Het
Rftn2 C T 1: 55,214,286 V53I probably damaging Het
Rnaset2a T C 17: 8,132,047 Y167C probably damaging Het
Schip1 T C 3: 68,408,227 probably benign Het
Scn5a A C 9: 119,530,052 L643R possibly damaging Het
Shroom3 T A 5: 92,943,018 M1128K probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc14a2 A G 18: 78,209,042 L18P probably benign Het
Slc22a3 C T 17: 12,423,804 V509M probably damaging Het
Slc7a5 A C 8: 121,883,642 F478V probably benign Het
Smc1b T A 15: 85,096,658 N803I probably benign Het
Snf8 T A 11: 96,041,725 N115K probably damaging Het
Stox2 T A 8: 47,413,137 K57* probably null Het
Tmem248 T A 5: 130,229,588 F41I probably damaging Het
Tmprss7 T C 16: 45,686,430 S90G probably damaging Het
Top3b T C 16: 16,885,836 V285A probably damaging Het
Tsen15 T C 1: 152,371,783 T153A probably damaging Het
Usp34 T G 11: 23,354,846 S360A probably benign Het
Wdr24 T C 17: 25,828,340 probably null Het
Zbtb2 G A 10: 4,369,456 T190I probably benign Het
Zranb3 T C 1: 127,963,876 S788G probably benign Het
Other mutations in Nuak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Nuak1 APN 10 84375134 missense probably damaging 1.00
IGL01374:Nuak1 APN 10 84374668 missense probably damaging 0.96
IGL02967:Nuak1 APN 10 84440221 missense probably damaging 1.00
IGL03207:Nuak1 APN 10 84440129 missense possibly damaging 0.84
R0002:Nuak1 UTSW 10 84375367 missense probably damaging 1.00
R0277:Nuak1 UTSW 10 84374451 missense probably benign 0.02
R0749:Nuak1 UTSW 10 84374784 missense probably damaging 1.00
R0906:Nuak1 UTSW 10 84375280 missense probably damaging 1.00
R1227:Nuak1 UTSW 10 84440309 missense probably benign
R1367:Nuak1 UTSW 10 84392328 splice site probably benign
R1778:Nuak1 UTSW 10 84374874 unclassified probably null
R2151:Nuak1 UTSW 10 84409645 missense probably benign 0.00
R2877:Nuak1 UTSW 10 84375345 missense possibly damaging 0.79
R3863:Nuak1 UTSW 10 84378087 splice site probably null
R4386:Nuak1 UTSW 10 84394044 missense probably damaging 1.00
R4849:Nuak1 UTSW 10 84375279 missense probably damaging 1.00
R4962:Nuak1 UTSW 10 84375115 missense probably damaging 1.00
R5118:Nuak1 UTSW 10 84374984 missense probably benign 0.04
R5134:Nuak1 UTSW 10 84374350 missense probably benign 0.01
R5248:Nuak1 UTSW 10 84409678 missense probably damaging 1.00
R5590:Nuak1 UTSW 10 84375255 missense probably benign
R5933:Nuak1 UTSW 10 84374802 missense probably damaging 0.99
R7067:Nuak1 UTSW 10 84440294 missense possibly damaging 0.59
R7169:Nuak1 UTSW 10 84374745 missense probably damaging 1.00
R7342:Nuak1 UTSW 10 84374967 missense probably damaging 1.00
R7549:Nuak1 UTSW 10 84374539 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGCAAAATATTTGGCTCCTGC -3'
(R):5'- CAAGCCCTGGGTGTTTATAAACG -3'

Sequencing Primer
(F):5'- GGGCAATTACCTCAAAGTCTTGGC -3'
(R):5'- TTTATAAACGGAACACATTGCAGGG -3'
Posted On2017-01-03