Incidental Mutation 'R5719:2610507B11Rik'
ID451366
Institutional Source Beutler Lab
Gene Symbol 2610507B11Rik
Ensembl Gene ENSMUSG00000010277
Gene NameRIKEN cDNA 2610507B11 gene
SynonymsD11Bhm178e, D11Bhm179e, E1
MMRRC Submission 043339-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R5719 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location78261752-78290623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78273245 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1137 (H1137Q)
Ref Sequence ENSEMBL: ENSMUSP00000010421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010421]
Predicted Effect probably damaging
Transcript: ENSMUST00000010421
AA Change: H1137Q

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000010421
Gene: ENSMUSG00000010277
AA Change: H1137Q

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
Pfam:Fmp27 26 475 1.6e-45 PFAM
Pfam:Fmp27 446 674 3.2e-24 PFAM
low complexity region 719 734 N/A INTRINSIC
low complexity region 785 798 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
Fmp27_GFWDK 1028 1160 3.01e-61 SMART
low complexity region 1415 1421 N/A INTRINSIC
low complexity region 1690 1701 N/A INTRINSIC
Pfam:Apt1 1703 2176 2.4e-112 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132756
Predicted Effect unknown
Transcript: ENSMUST00000145145
AA Change: H31Q
SMART Domains Protein: ENSMUSP00000119105
Gene: ENSMUSG00000010277
AA Change: H31Q

DomainStartEndE-ValueType
Pfam:Fmp27_GFWDK 1 52 1.2e-20 PFAM
Meta Mutation Damage Score 0.9318 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (79/81)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130051J06Rik C T 15: 95,790,760 probably benign Het
A630001G21Rik T A 1: 85,723,385 R110W probably benign Het
Abca4 T C 3: 122,135,266 probably null Het
Abcc3 T C 11: 94,351,068 N1379S probably damaging Het
Actrt3 A C 3: 30,598,127 F273V probably benign Het
Adam22 T C 5: 8,367,217 D75G probably benign Het
Armc4 G T 18: 7,211,496 Q793K probably benign Het
Ash1l C A 3: 89,054,498 D2392E possibly damaging Het
Ash1l T C 3: 89,058,626 I2445T probably damaging Het
Cacna2d2 A G 9: 107,524,652 I762V probably benign Het
Ccdc127 T A 13: 74,357,068 probably benign Het
Ccdc91 C G 6: 147,575,503 L230V unknown Het
Cdk13 A G 13: 17,719,655 I1129T probably damaging Het
Cnot1 C T 8: 95,744,296 R1308H possibly damaging Het
Crhr2 T C 6: 55,103,222 H144R probably damaging Het
Dnmt1 T C 9: 20,912,595 N993S possibly damaging Het
Eif4g1 T A 16: 20,689,011 V1182D probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam234a T A 17: 26,214,653 Q399L possibly damaging Het
Fyb A T 15: 6,580,869 K308* probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm10309 A T 17: 86,498,993 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm5501 G A 18: 9,917,417 noncoding transcript Het
Gm6309 A T 5: 146,168,182 V307D probably benign Het
Gm9871 T A 6: 101,796,187 noncoding transcript Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Herc3 T A 6: 58,894,543 V70E possibly damaging Het
Hes7 A G 11: 69,121,589 E41G probably damaging Het
Ifi27l2b T C 12: 103,455,787 D106G unknown Het
Igfbp6 A T 15: 102,148,181 Y184F probably damaging Het
Isyna1 A G 8: 70,594,702 Y25C probably damaging Het
Kcng3 G T 17: 83,631,134 T162K possibly damaging Het
Krt36 T C 11: 100,104,161 D195G possibly damaging Het
Lrwd1 A T 5: 136,132,239 probably null Het
Lsg1 C T 16: 30,561,775 A615T probably benign Het
Myo5a A T 9: 75,151,931 E480D probably damaging Het
Myrf T A 19: 10,216,723 D690V probably damaging Het
N4bp1 T C 8: 86,851,684 I684M probably damaging Het
Nlrc3 C T 16: 3,963,725 A607T probably damaging Het
Nuak1 A T 10: 84,409,720 I87N probably damaging Het
Olfr1131 T C 2: 87,629,131 probably null Het
Olfr490 T G 7: 108,286,392 T245P probably damaging Het
Olfr878 A T 9: 37,919,351 E236D probably damaging Het
Osbpl9 T A 4: 109,062,566 R689* probably null Het
Ppargc1b T A 18: 61,307,568 M744L probably benign Het
Prss40 A T 1: 34,552,517 probably benign Het
Ptprd T A 4: 76,054,602 probably null Het
Rft1 T C 14: 30,663,226 probably benign Het
Rftn2 C T 1: 55,214,286 V53I probably damaging Het
Rnaset2a T C 17: 8,132,047 Y167C probably damaging Het
Schip1 T C 3: 68,408,227 probably benign Het
Scn5a A C 9: 119,530,052 L643R possibly damaging Het
Shroom3 T A 5: 92,943,018 M1128K probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc14a2 A G 18: 78,209,042 L18P probably benign Het
Slc22a3 C T 17: 12,423,804 V509M probably damaging Het
Slc7a5 A C 8: 121,883,642 F478V probably benign Het
Smc1b T A 15: 85,096,658 N803I probably benign Het
Snf8 T A 11: 96,041,725 N115K probably damaging Het
Stox2 T A 8: 47,413,137 K57* probably null Het
Tmem248 T A 5: 130,229,588 F41I probably damaging Het
Tmprss7 T C 16: 45,686,430 S90G probably damaging Het
Top3b T C 16: 16,885,836 V285A probably damaging Het
Tsen15 T C 1: 152,371,783 T153A probably damaging Het
Usp34 T G 11: 23,354,846 S360A probably benign Het
Wdr24 T C 17: 25,828,340 probably null Het
Zbtb2 G A 10: 4,369,456 T190I probably benign Het
Zranb3 T C 1: 127,963,876 S788G probably benign Het
Other mutations in 2610507B11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:2610507B11Rik APN 11 78269574 missense possibly damaging 0.55
IGL00497:2610507B11Rik APN 11 78272933 missense probably damaging 1.00
IGL00797:2610507B11Rik APN 11 78273150 missense probably benign 0.07
IGL01695:2610507B11Rik APN 11 78265193 missense probably benign 0.03
IGL02055:2610507B11Rik APN 11 78286631 missense probably damaging 1.00
IGL02066:2610507B11Rik APN 11 78273232 missense probably damaging 1.00
IGL02231:2610507B11Rik APN 11 78279896 missense probably benign
IGL02282:2610507B11Rik APN 11 78284228 missense probably benign 0.22
IGL02293:2610507B11Rik APN 11 78271910 missense probably damaging 1.00
IGL02336:2610507B11Rik APN 11 78289032 missense probably damaging 1.00
IGL02528:2610507B11Rik APN 11 78271976 missense possibly damaging 0.93
IGL03231:2610507B11Rik APN 11 78268702 missense probably benign 0.02
R0003:2610507B11Rik UTSW 11 78286578 missense possibly damaging 0.66
R0197:2610507B11Rik UTSW 11 78269704 unclassified probably benign
R0244:2610507B11Rik UTSW 11 78286491 unclassified probably null
R0281:2610507B11Rik UTSW 11 78271924 missense possibly damaging 0.88
R0396:2610507B11Rik UTSW 11 78268377 missense possibly damaging 0.93
R0624:2610507B11Rik UTSW 11 78268457 missense probably damaging 1.00
R0666:2610507B11Rik UTSW 11 78287987 missense probably damaging 1.00
R0666:2610507B11Rik UTSW 11 78277212 nonsense probably null
R1313:2610507B11Rik UTSW 11 78265672 missense probably benign 0.02
R1313:2610507B11Rik UTSW 11 78265672 missense probably benign 0.02
R1443:2610507B11Rik UTSW 11 78262798 missense probably damaging 1.00
R1485:2610507B11Rik UTSW 11 78285580 missense probably damaging 1.00
R1500:2610507B11Rik UTSW 11 78284132 missense possibly damaging 0.46
R1537:2610507B11Rik UTSW 11 78289343 missense probably damaging 1.00
R1543:2610507B11Rik UTSW 11 78275174 missense probably benign 0.44
R1702:2610507B11Rik UTSW 11 78289028 missense probably damaging 1.00
R1804:2610507B11Rik UTSW 11 78273469 missense probably damaging 1.00
R1835:2610507B11Rik UTSW 11 78287750 missense probably damaging 0.97
R1852:2610507B11Rik UTSW 11 78268473 missense probably damaging 1.00
R1861:2610507B11Rik UTSW 11 78287929 unclassified probably benign
R1986:2610507B11Rik UTSW 11 78274612 missense probably damaging 1.00
R1987:2610507B11Rik UTSW 11 78268167 missense probably damaging 1.00
R2061:2610507B11Rik UTSW 11 78268749 nonsense probably null
R2113:2610507B11Rik UTSW 11 78268772 missense probably benign 0.02
R3692:2610507B11Rik UTSW 11 78269509 missense probably damaging 1.00
R3788:2610507B11Rik UTSW 11 78288297 critical splice donor site probably null
R3835:2610507B11Rik UTSW 11 78279085 missense probably benign 0.17
R3882:2610507B11Rik UTSW 11 78262700 missense probably damaging 1.00
R3943:2610507B11Rik UTSW 11 78269524 nonsense probably null
R3944:2610507B11Rik UTSW 11 78269524 nonsense probably null
R3945:2610507B11Rik UTSW 11 78289964 missense probably damaging 1.00
R4196:2610507B11Rik UTSW 11 78263556 intron probably benign
R4510:2610507B11Rik UTSW 11 78277328 missense possibly damaging 0.59
R4511:2610507B11Rik UTSW 11 78277328 missense possibly damaging 0.59
R4756:2610507B11Rik UTSW 11 78264028 missense probably damaging 0.98
R5337:2610507B11Rik UTSW 11 78265208 missense possibly damaging 0.46
R5419:2610507B11Rik UTSW 11 78272090 nonsense probably null
R5572:2610507B11Rik UTSW 11 78264567 missense probably damaging 0.98
R5754:2610507B11Rik UTSW 11 78269541 missense probably damaging 1.00
R5890:2610507B11Rik UTSW 11 78273270 nonsense probably null
R5919:2610507B11Rik UTSW 11 78289350 missense probably damaging 1.00
R5925:2610507B11Rik UTSW 11 78284238 missense probably benign 0.06
R5976:2610507B11Rik UTSW 11 78284129 missense probably benign 0.00
R5999:2610507B11Rik UTSW 11 78285468 missense probably damaging 1.00
R6056:2610507B11Rik UTSW 11 78271384 missense possibly damaging 0.77
R6180:2610507B11Rik UTSW 11 78273258 missense possibly damaging 0.51
R6484:2610507B11Rik UTSW 11 78279095 missense probably damaging 1.00
R6721:2610507B11Rik UTSW 11 78279799 missense probably damaging 1.00
R6800:2610507B11Rik UTSW 11 78288279 missense probably benign 0.13
R6911:2610507B11Rik UTSW 11 78268353 missense probably damaging 0.99
R6923:2610507B11Rik UTSW 11 78274626 missense possibly damaging 0.67
R7283:2610507B11Rik UTSW 11 78274828 missense probably damaging 1.00
R7287:2610507B11Rik UTSW 11 78272883 missense possibly damaging 0.61
R7339:2610507B11Rik UTSW 11 78272384 critical splice donor site probably null
R7409:2610507B11Rik UTSW 11 78268757 missense probably damaging 1.00
R7473:2610507B11Rik UTSW 11 78267115 missense possibly damaging 0.86
R7704:2610507B11Rik UTSW 11 78268744 missense probably benign 0.29
R7793:2610507B11Rik UTSW 11 78273205 missense possibly damaging 0.56
X0028:2610507B11Rik UTSW 11 78286635 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTAAGCCTGCATTCCTCTACC -3'
(R):5'- ACTCCCAGTGCATGTTCTCAG -3'

Sequencing Primer
(F):5'- TCCTCTACCCTAGCGGAAATC -3'
(R):5'- CTCAGTTGTATTATAGGGGTCCTAC -3'
Posted On2017-01-03