Incidental Mutation 'R5719:Gm11595'
ID451369
Institutional Source Beutler Lab
Gene Symbol Gm11595
Ensembl Gene ENSMUSG00000078668
Gene Namepredicted gene 11595
Synonyms
MMRRC Submission 043339-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5719 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location99771714-99772913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99772555 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 100 (R100C)
Ref Sequence ENSEMBL: ENSMUSP00000103064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107440]
Predicted Effect unknown
Transcript: ENSMUST00000107440
AA Change: R100C
SMART Domains Protein: ENSMUSP00000103064
Gene: ENSMUSG00000078668
AA Change: R100C

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 47 7.5e-9 PFAM
Pfam:Keratin_B2_2 14 58 2.8e-13 PFAM
Pfam:Keratin_B2_2 29 73 1.2e-13 PFAM
Pfam:Keratin_B2_2 72 112 2.3e-12 PFAM
Pfam:Keratin_B2_2 107 152 4.6e-14 PFAM
Pfam:Keratin_B2_2 118 162 1.1e-13 PFAM
Pfam:Keratin_B2_2 143 187 3.5e-10 PFAM
Pfam:Keratin_B2_2 168 212 5.6e-13 PFAM
Pfam:Keratin_B2_2 178 222 2.4e-12 PFAM
Pfam:Keratin_B2_2 208 257 1.6e-11 PFAM
Pfam:Keratin_B2_2 223 267 4e-14 PFAM
Pfam:Keratin_B2_2 248 289 9e-9 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (79/81)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,273,245 H1137Q probably damaging Het
A130051J06Rik C T 15: 95,790,760 probably benign Het
A630001G21Rik T A 1: 85,723,385 R110W probably benign Het
Abca4 T C 3: 122,135,266 probably null Het
Abcc3 T C 11: 94,351,068 N1379S probably damaging Het
Actrt3 A C 3: 30,598,127 F273V probably benign Het
Adam22 T C 5: 8,367,217 D75G probably benign Het
Armc4 G T 18: 7,211,496 Q793K probably benign Het
Ash1l C A 3: 89,054,498 D2392E possibly damaging Het
Ash1l T C 3: 89,058,626 I2445T probably damaging Het
Cacna2d2 A G 9: 107,524,652 I762V probably benign Het
Ccdc127 T A 13: 74,357,068 probably benign Het
Ccdc91 C G 6: 147,575,503 L230V unknown Het
Cdk13 A G 13: 17,719,655 I1129T probably damaging Het
Cnot1 C T 8: 95,744,296 R1308H possibly damaging Het
Crhr2 T C 6: 55,103,222 H144R probably damaging Het
Dnmt1 T C 9: 20,912,595 N993S possibly damaging Het
Eif4g1 T A 16: 20,689,011 V1182D probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam234a T A 17: 26,214,653 Q399L possibly damaging Het
Fyb A T 15: 6,580,869 K308* probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm10309 A T 17: 86,498,993 probably benign Het
Gm5501 G A 18: 9,917,417 noncoding transcript Het
Gm6309 A T 5: 146,168,182 V307D probably benign Het
Gm9871 T A 6: 101,796,187 noncoding transcript Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Herc3 T A 6: 58,894,543 V70E possibly damaging Het
Hes7 A G 11: 69,121,589 E41G probably damaging Het
Ifi27l2b T C 12: 103,455,787 D106G unknown Het
Igfbp6 A T 15: 102,148,181 Y184F probably damaging Het
Isyna1 A G 8: 70,594,702 Y25C probably damaging Het
Kcng3 G T 17: 83,631,134 T162K possibly damaging Het
Krt36 T C 11: 100,104,161 D195G possibly damaging Het
Lrwd1 A T 5: 136,132,239 probably null Het
Lsg1 C T 16: 30,561,775 A615T probably benign Het
Myo5a A T 9: 75,151,931 E480D probably damaging Het
Myrf T A 19: 10,216,723 D690V probably damaging Het
N4bp1 T C 8: 86,851,684 I684M probably damaging Het
Nlrc3 C T 16: 3,963,725 A607T probably damaging Het
Nuak1 A T 10: 84,409,720 I87N probably damaging Het
Olfr1131 T C 2: 87,629,131 probably null Het
Olfr490 T G 7: 108,286,392 T245P probably damaging Het
Olfr878 A T 9: 37,919,351 E236D probably damaging Het
Osbpl9 T A 4: 109,062,566 R689* probably null Het
Ppargc1b T A 18: 61,307,568 M744L probably benign Het
Prss40 A T 1: 34,552,517 probably benign Het
Ptprd T A 4: 76,054,602 probably null Het
Rft1 T C 14: 30,663,226 probably benign Het
Rftn2 C T 1: 55,214,286 V53I probably damaging Het
Rnaset2a T C 17: 8,132,047 Y167C probably damaging Het
Schip1 T C 3: 68,408,227 probably benign Het
Scn5a A C 9: 119,530,052 L643R possibly damaging Het
Shroom3 T A 5: 92,943,018 M1128K probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc14a2 A G 18: 78,209,042 L18P probably benign Het
Slc22a3 C T 17: 12,423,804 V509M probably damaging Het
Slc7a5 A C 8: 121,883,642 F478V probably benign Het
Smc1b T A 15: 85,096,658 N803I probably benign Het
Snf8 T A 11: 96,041,725 N115K probably damaging Het
Stox2 T A 8: 47,413,137 K57* probably null Het
Tmem248 T A 5: 130,229,588 F41I probably damaging Het
Tmprss7 T C 16: 45,686,430 S90G probably damaging Het
Top3b T C 16: 16,885,836 V285A probably damaging Het
Tsen15 T C 1: 152,371,783 T153A probably damaging Het
Usp34 T G 11: 23,354,846 S360A probably benign Het
Wdr24 T C 17: 25,828,340 probably null Het
Zbtb2 G A 10: 4,369,456 T190I probably benign Het
Zranb3 T C 1: 127,963,876 S788G probably benign Het
Other mutations in Gm11595
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Gm11595 APN 11 99772042 missense unknown
IGL00987:Gm11595 APN 11 99772539 missense unknown
IGL01662:Gm11595 APN 11 99772672 missense unknown
IGL01994:Gm11595 APN 11 99772201 missense unknown
R0548:Gm11595 UTSW 11 99772141 missense unknown
R1923:Gm11595 UTSW 11 99772539 missense unknown
R2127:Gm11595 UTSW 11 99772501 missense unknown
R2128:Gm11595 UTSW 11 99772501 missense unknown
R3807:Gm11595 UTSW 11 99772554 missense unknown
R4007:Gm11595 UTSW 11 99772035 missense unknown
R5281:Gm11595 UTSW 11 99772555 missense unknown
R5283:Gm11595 UTSW 11 99772555 missense unknown
R5303:Gm11595 UTSW 11 99772555 missense unknown
R5305:Gm11595 UTSW 11 99772555 missense unknown
R5306:Gm11595 UTSW 11 99772555 missense unknown
R5307:Gm11595 UTSW 11 99772555 missense unknown
R5308:Gm11595 UTSW 11 99772555 missense unknown
R5561:Gm11595 UTSW 11 99772555 missense unknown
R5637:Gm11595 UTSW 11 99772555 missense unknown
R5639:Gm11595 UTSW 11 99772555 missense unknown
R5718:Gm11595 UTSW 11 99772555 missense unknown
R5720:Gm11595 UTSW 11 99772555 missense unknown
R5721:Gm11595 UTSW 11 99772555 missense unknown
R5769:Gm11595 UTSW 11 99772555 missense unknown
R5770:Gm11595 UTSW 11 99772555 missense unknown
R5771:Gm11595 UTSW 11 99772555 missense unknown
R5791:Gm11595 UTSW 11 99772555 missense unknown
R5841:Gm11595 UTSW 11 99772317 missense unknown
R6054:Gm11595 UTSW 11 99772648 missense unknown
R6277:Gm11595 UTSW 11 99772684 missense unknown
R6281:Gm11595 UTSW 11 99772555 missense unknown
R6282:Gm11595 UTSW 11 99772555 missense unknown
R6310:Gm11595 UTSW 11 99772555 missense unknown
R6321:Gm11595 UTSW 11 99772555 missense unknown
R6322:Gm11595 UTSW 11 99772555 missense unknown
R6327:Gm11595 UTSW 11 99772555 missense unknown
R6337:Gm11595 UTSW 11 99772555 missense unknown
R6368:Gm11595 UTSW 11 99772555 missense unknown
R6369:Gm11595 UTSW 11 99772555 missense unknown
R6431:Gm11595 UTSW 11 99772774 missense unknown
R6483:Gm11595 UTSW 11 99772555 missense unknown
R6485:Gm11595 UTSW 11 99772555 missense unknown
R6493:Gm11595 UTSW 11 99772555 missense unknown
R6758:Gm11595 UTSW 11 99772540 missense unknown
R6758:Gm11595 UTSW 11 99772541 nonsense probably null
R7037:Gm11595 UTSW 11 99772648 missense unknown
R8053:Gm11595 UTSW 11 99772128 missense not run
Predicted Primers PCR Primer
(F):5'- TAGAACTACCACAGCAGGGG -3'
(R):5'- ACCATGGTCAGTTCCTGTTGTG -3'

Sequencing Primer
(F):5'- CGACAGCAGCTGGAGATG -3'
(R):5'- TGCCAGACCACCTGCTGTAG -3'
Posted On2017-01-03