Incidental Mutation 'R0551:Acmsd'
ID 45137
Institutional Source Beutler Lab
Gene Symbol Acmsd
Ensembl Gene ENSMUSG00000026348
Gene Name amino carboxymuconate semialdehyde decarboxylase
Synonyms
MMRRC Submission 038743-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0551 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 127657150-127695715 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 127694070 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 333 (K333N)
Ref Sequence ENSEMBL: ENSMUSP00000048482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038006]
AlphaFold Q8R519
Predicted Effect probably benign
Transcript: ENSMUST00000038006
AA Change: K333N

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000048482
Gene: ENSMUSG00000026348
AA Change: K333N

DomainStartEndE-ValueType
Pfam:Amidohydro_2 3 330 7.8e-78 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188163
Meta Mutation Damage Score 0.0607 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The neuronal excitotoxin quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan, and has been implicated in the pathogenesis of several neurodegenerative disorders. Quinolinate is derived from alpha-amino-beta-carboxy-muconate-epsilon-semialdehyde (ACMS). ACMSD (ACMS decarboxylase; EC 4.1.1.45) can divert ACMS to a benign catabolite and thus prevent the accumulation of quinolinate from ACMS.[supplied by OMIM, Oct 2004]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,384,598 (GRCm39) T456S probably benign Het
Adcy2 T A 13: 68,944,658 (GRCm39) K241N probably damaging Het
Aebp1 A G 11: 5,817,955 (GRCm39) I77V probably benign Het
Albfm1 C T 5: 90,720,578 (GRCm39) P250S probably damaging Het
Ankrd35 A G 3: 96,591,276 (GRCm39) T521A probably benign Het
Arap2 C T 5: 62,798,666 (GRCm39) probably null Het
Arfgap3 A T 15: 83,227,338 (GRCm39) C25S probably damaging Het
Arhgap20 T A 9: 51,737,125 (GRCm39) probably benign Het
Arhgap39 C T 15: 76,619,086 (GRCm39) D833N probably damaging Het
Auts2 T C 5: 131,469,307 (GRCm39) E446G possibly damaging Het
Brwd1 C T 16: 95,837,174 (GRCm39) R886H probably damaging Het
Carm1 G A 9: 21,491,787 (GRCm39) probably null Het
Cdc5l G A 17: 45,726,610 (GRCm39) R321W probably damaging Het
Cfap54 A T 10: 92,860,984 (GRCm39) M841K probably benign Het
Clca4b T A 3: 144,634,387 (GRCm39) T69S probably damaging Het
Cpox A G 16: 58,495,753 (GRCm39) I357V probably benign Het
Diaph3 C A 14: 87,147,536 (GRCm39) V711L probably benign Het
Fabp3-ps1 T C 10: 86,567,904 (GRCm39) probably benign Het
Fam120b A T 17: 15,651,905 (GRCm39) probably benign Het
Fcho1 A G 8: 72,164,818 (GRCm39) S488P probably benign Het
Flcn A G 11: 59,686,574 (GRCm39) probably null Het
Flt3l A G 7: 44,781,690 (GRCm39) W234R probably damaging Het
Fzd7 G T 1: 59,522,443 (GRCm39) V109L probably damaging Het
G3bp1 A G 11: 55,379,969 (GRCm39) N101S probably benign Het
Gadd45g A G 13: 52,001,963 (GRCm39) E143G probably damaging Het
Ganab T G 19: 8,884,644 (GRCm39) I149S probably benign Het
Garnl3 A G 2: 32,906,750 (GRCm39) S413P probably damaging Het
Glis1 C T 4: 107,425,316 (GRCm39) probably null Het
Gm11563 A G 11: 99,549,539 (GRCm39) S72P unknown Het
Gpd1 T G 15: 99,618,510 (GRCm39) I188S possibly damaging Het
Gria2 A G 3: 80,639,333 (GRCm39) probably benign Het
Hpcal4 G T 4: 123,082,848 (GRCm39) A65S possibly damaging Het
Igsf10 G A 3: 59,236,089 (GRCm39) T1364I probably benign Het
Kdm4a T C 4: 117,995,428 (GRCm39) *1065W probably null Het
Klkb1 A G 8: 45,731,003 (GRCm39) probably null Het
Lipo3 T C 19: 33,557,951 (GRCm39) D147G probably damaging Het
Lrp1 A G 10: 127,407,827 (GRCm39) S1821P probably benign Het
Macroh2a2 A G 10: 61,576,945 (GRCm39) S308P probably damaging Het
Manba T C 3: 135,223,734 (GRCm39) I207T probably damaging Het
Mark3 T A 12: 111,600,068 (GRCm39) S428T probably benign Het
Mfsd4a G A 1: 131,969,657 (GRCm39) T348I probably damaging Het
Mybbp1a A G 11: 72,339,202 (GRCm39) M880V probably benign Het
N4bp2 T A 5: 65,977,684 (GRCm39) probably null Het
Nrdc T G 4: 108,904,905 (GRCm39) I712S probably damaging Het
Nup210 G A 6: 90,998,466 (GRCm39) R774C possibly damaging Het
Obscn G A 11: 58,998,688 (GRCm39) R1395* probably null Het
Or5b102 T A 19: 13,041,658 (GRCm39) D294E probably benign Het
Pcdh7 T C 5: 57,879,336 (GRCm39) Y964H probably damaging Het
Pgap6 C A 17: 26,339,576 (GRCm39) Q605K probably damaging Het
Plin4 T C 17: 56,413,756 (GRCm39) T290A probably benign Het
Ppara T C 15: 85,671,306 (GRCm39) probably benign Het
Psg21 T G 7: 18,386,565 (GRCm39) probably null Het
Ptar1 C A 19: 23,697,704 (GRCm39) N405K probably benign Het
Ralgps2 A G 1: 156,660,233 (GRCm39) probably null Het
Rnf6 T A 5: 146,148,205 (GRCm39) N271I possibly damaging Het
Sis T C 3: 72,832,740 (GRCm39) D1019G possibly damaging Het
Slc37a3 A G 6: 39,329,688 (GRCm39) probably benign Het
Slc49a3 A G 5: 108,592,331 (GRCm39) probably benign Het
Slc6a12 G A 6: 121,333,877 (GRCm39) V238I probably damaging Het
Sntg1 C A 1: 8,624,960 (GRCm39) V279L possibly damaging Het
Sorbs1 T A 19: 40,300,260 (GRCm39) E567D probably damaging Het
Sp110 C A 1: 85,516,821 (GRCm39) probably benign Het
Ssu2 A G 6: 112,357,515 (GRCm39) V175A possibly damaging Het
Stk36 G A 1: 74,655,780 (GRCm39) E428K probably benign Het
Teddm1b A T 1: 153,751,090 (GRCm39) I300F possibly damaging Het
Thy1 T C 9: 43,958,645 (GRCm39) V129A probably damaging Het
Tiam2 T A 17: 3,479,229 (GRCm39) M654K probably damaging Het
Tmem69 T C 4: 116,410,470 (GRCm39) S167G probably benign Het
Tmem81 C G 1: 132,435,567 (GRCm39) I124M probably damaging Het
Tspan10 A G 11: 120,335,244 (GRCm39) D118G probably damaging Het
Tspo2 A G 17: 48,755,841 (GRCm39) probably benign Het
Ttn G A 2: 76,738,672 (GRCm39) Q4002* probably null Het
Tyro3 G A 2: 119,647,385 (GRCm39) R834Q probably damaging Het
Ugt2b1 T C 5: 87,073,943 (GRCm39) K139E probably benign Het
Vmn1r9 A T 6: 57,048,524 (GRCm39) I200F probably benign Het
Other mutations in Acmsd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01586:Acmsd APN 1 127,687,447 (GRCm39) missense probably damaging 1.00
IGL02203:Acmsd APN 1 127,666,342 (GRCm39) splice site probably benign
IGL02209:Acmsd APN 1 127,687,492 (GRCm39) missense probably damaging 1.00
IGL02429:Acmsd APN 1 127,687,453 (GRCm39) missense probably damaging 1.00
IGL02577:Acmsd APN 1 127,667,696 (GRCm39) missense probably benign 0.05
IGL02724:Acmsd APN 1 127,676,822 (GRCm39) missense possibly damaging 0.84
IGL03215:Acmsd APN 1 127,685,750 (GRCm39) nonsense probably null
H8562:Acmsd UTSW 1 127,676,795 (GRCm39) missense probably benign
R0535:Acmsd UTSW 1 127,693,680 (GRCm39) missense probably benign 0.10
R0593:Acmsd UTSW 1 127,666,340 (GRCm39) splice site probably benign
R1282:Acmsd UTSW 1 127,666,297 (GRCm39) missense probably damaging 0.99
R1633:Acmsd UTSW 1 127,681,592 (GRCm39) missense probably benign 0.33
R1800:Acmsd UTSW 1 127,687,493 (GRCm39) nonsense probably null
R3018:Acmsd UTSW 1 127,676,853 (GRCm39) missense probably benign 0.11
R4195:Acmsd UTSW 1 127,676,931 (GRCm39) missense probably damaging 1.00
R4196:Acmsd UTSW 1 127,676,931 (GRCm39) missense probably damaging 1.00
R4288:Acmsd UTSW 1 127,666,309 (GRCm39) missense probably damaging 1.00
R4591:Acmsd UTSW 1 127,676,934 (GRCm39) missense probably damaging 0.99
R5172:Acmsd UTSW 1 127,681,585 (GRCm39) nonsense probably null
R5637:Acmsd UTSW 1 127,694,050 (GRCm39) missense probably damaging 0.99
R6147:Acmsd UTSW 1 127,657,157 (GRCm39) start gained probably benign
R7055:Acmsd UTSW 1 127,681,570 (GRCm39) missense probably benign 0.10
R7261:Acmsd UTSW 1 127,687,561 (GRCm39) missense probably damaging 1.00
R7398:Acmsd UTSW 1 127,657,172 (GRCm39) start gained probably benign
R8030:Acmsd UTSW 1 127,676,898 (GRCm39) missense possibly damaging 0.50
R9081:Acmsd UTSW 1 127,687,468 (GRCm39) missense possibly damaging 0.94
X0067:Acmsd UTSW 1 127,687,468 (GRCm39) missense probably benign 0.42
Z1176:Acmsd UTSW 1 127,673,539 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAGCCCATCCTGAGCTGAA -3'
(R):5'- GTCAACATAGAGACCCCGAGCCTTC -3'

Sequencing Primer
(F):5'- GACTCCACTTTCTGAAATAGCTAGAC -3'
(R):5'- gttttagacagtctcaagtagcc -3'
Posted On 2013-06-11