Mutagenetix > Incidental Mutations

Incidental Mutation 'R5719:Smc1b'

451376

Institutional Source

Beutler Lab

Gene Symbol

Smc1b

Ensembl Gene

ENSMUSG00000022432

Gene Name

structural maintenance of chromosomes 1B

Synonyms

SMC1beta, Smc1l2

MMRRC Submission

043339-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.596) question?

Stock #

R5719 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85064689-85131964 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 85096658 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 803 (N803I)

Ref Sequence

ENSEMBL: ENSMUSP00000023068 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023068]

Predicted Effect

probably benign
Transcript: ENSMUST00000023068
AA Change: N803I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000023068
Gene: ENSMUSG00000022432
AA Change: N803I

Domain	Start	End	E-Value	Type
Pfam:AAA_23	7	361	2e-10	PFAM
Pfam:AAA_21	27	372	7.2e-9	PFAM
low complexity region	422	437	N/A	INTRINSIC
SMC_hinge	513	629	1.5e-23	SMART
PDB:1W1W\|D	1046	1218	3e-42	PDB
Blast:AAA	1063	1217	5e-25	BLAST
SCOP:d1e69a_	1114	1202	3e-5	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

98% (79/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SMC1L2 belongs to a family of proteins required for chromatid cohesion and DNA recombination during meiosis and mitosis (3:Revenkova et al., 2001 [PubMed 11564881]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice display male and female infertility, abnormal male and female meiosis, and arrest of spematogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,273,245	H1137Q	probably damaging	Het
A130051J06Rik	C	T	15: 95,790,760		probably benign	Het
A630001G21Rik	T	A	1: 85,723,385	R110W	probably benign	Het
Abca4	T	C	3: 122,135,266		probably null	Het
Abcc3	T	C	11: 94,351,068	N1379S	probably damaging	Het
Actrt3	A	C	3: 30,598,127	F273V	probably benign	Het
Adam22	T	C	5: 8,367,217	D75G	probably benign	Het
Armc4	G	T	18: 7,211,496	Q793K	probably benign	Het
Ash1l	C	A	3: 89,054,498	D2392E	possibly damaging	Het
Ash1l	T	C	3: 89,058,626	I2445T	probably damaging	Het
Cacna2d2	A	G	9: 107,524,652	I762V	probably benign	Het
Ccdc127	T	A	13: 74,357,068		probably benign	Het
Ccdc91	C	G	6: 147,575,503	L230V	unknown	Het
Cdk13	A	G	13: 17,719,655	I1129T	probably damaging	Het
Cnot1	C	T	8: 95,744,296	R1308H	possibly damaging	Het
Crhr2	T	C	6: 55,103,222	H144R	probably damaging	Het
Dnmt1	T	C	9: 20,912,595	N993S	possibly damaging	Het
Eif4g1	T	A	16: 20,689,011	V1182D	probably damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fam234a	T	A	17: 26,214,653	Q399L	possibly damaging	Het
Fyb	A	T	15: 6,580,869	K308*	probably null	Het
Gfral	C	T	9: 76,197,046	R228Q	probably benign	Het
Gm10309	A	T	17: 86,498,993		probably benign	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gm5501	G	A	18: 9,917,417		noncoding transcript	Het
Gm6309	A	T	5: 146,168,182	V307D	probably benign	Het
Gm9871	T	A	6: 101,796,187		noncoding transcript	Het
Greb1l	G	A	18: 10,542,427	E1341K	probably damaging	Het
Herc3	T	A	6: 58,894,543	V70E	possibly damaging	Het
Hes7	A	G	11: 69,121,589	E41G	probably damaging	Het
Ifi27l2b	T	C	12: 103,455,787	D106G	unknown	Het
Igfbp6	A	T	15: 102,148,181	Y184F	probably damaging	Het
Isyna1	A	G	8: 70,594,702	Y25C	probably damaging	Het
Kcng3	G	T	17: 83,631,134	T162K	possibly damaging	Het
Krt36	T	C	11: 100,104,161	D195G	possibly damaging	Het
Lrwd1	A	T	5: 136,132,239		probably null	Het
Lsg1	C	T	16: 30,561,775	A615T	probably benign	Het
Myo5a	A	T	9: 75,151,931	E480D	probably damaging	Het
Myrf	T	A	19: 10,216,723	D690V	probably damaging	Het
N4bp1	T	C	8: 86,851,684	I684M	probably damaging	Het
Nlrc3	C	T	16: 3,963,725	A607T	probably damaging	Het
Nuak1	A	T	10: 84,409,720	I87N	probably damaging	Het
Olfr1131	T	C	2: 87,629,131		probably null	Het
Olfr490	T	G	7: 108,286,392	T245P	probably damaging	Het
Olfr878	A	T	9: 37,919,351	E236D	probably damaging	Het
Osbpl9	T	A	4: 109,062,566	R689*	probably null	Het
Ppargc1b	T	A	18: 61,307,568	M744L	probably benign	Het
Prss40	A	T	1: 34,552,517		probably benign	Het
Ptprd	T	A	4: 76,054,602		probably null	Het
Rft1	T	C	14: 30,663,226		probably benign	Het
Rftn2	C	T	1: 55,214,286	V53I	probably damaging	Het
Rnaset2a	T	C	17: 8,132,047	Y167C	probably damaging	Het
Schip1	T	C	3: 68,408,227		probably benign	Het
Scn5a	A	C	9: 119,530,052	L643R	possibly damaging	Het
Shroom3	T	A	5: 92,943,018	M1128K	probably benign	Het
Skint8	C	A	4: 111,950,193	L359M	probably damaging	Het
Slc14a2	A	G	18: 78,209,042	L18P	probably benign	Het
Slc22a3	C	T	17: 12,423,804	V509M	probably damaging	Het
Slc7a5	A	C	8: 121,883,642	F478V	probably benign	Het
Snf8	T	A	11: 96,041,725	N115K	probably damaging	Het
Stox2	T	A	8: 47,413,137	K57*	probably null	Het
Tmem248	T	A	5: 130,229,588	F41I	probably damaging	Het
Tmprss7	T	C	16: 45,686,430	S90G	probably damaging	Het
Top3b	T	C	16: 16,885,836	V285A	probably damaging	Het
Tsen15	T	C	1: 152,371,783	T153A	probably damaging	Het
Usp34	T	G	11: 23,354,846	S360A	probably benign	Het
Wdr24	T	C	17: 25,828,340		probably null	Het
Zbtb2	G	A	10: 4,369,456	T190I	probably benign	Het
Zranb3	T	C	1: 127,963,876	S788G	probably benign	Het

Other mutations in Smc1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00736:Smc1b	APN	15	85129700	missense	possibly damaging	0.95
IGL01293:Smc1b	APN	15	85131898	missense	probably damaging	1.00
IGL01656:Smc1b	APN	15	85114776	missense	probably damaging	0.99
IGL01807:Smc1b	APN	15	85096745	missense	probably damaging	0.97
IGL02094:Smc1b	APN	15	85097891	splice site	probably benign
IGL02121:Smc1b	APN	15	85097985	missense	probably benign
IGL02631:Smc1b	APN	15	85107003	missense	probably damaging	0.98
IGL02678:Smc1b	APN	15	85065000	nonsense	probably null
IGL03197:Smc1b	APN	15	85070863	missense	possibly damaging	0.85
IGL03214:Smc1b	APN	15	85097946	nonsense	probably null
IGL03218:Smc1b	APN	15	85089713	missense	probably benign	0.07
IGL03232:Smc1b	APN	15	85129720	missense	possibly damaging	0.68
adamantine	UTSW	15	85121641	missense	probably benign	0.06
unbreakable	UTSW	15	85096658	missense	probably benign
E0370:Smc1b	UTSW	15	85127581	missense	probably damaging	1.00
PIT4812001:Smc1b	UTSW	15	85069651	missense	possibly damaging	0.91
R0092:Smc1b	UTSW	15	85067724	unclassified	probably benign
R0106:Smc1b	UTSW	15	85070819	missense	probably damaging	1.00
R0106:Smc1b	UTSW	15	85070819	missense	probably damaging	1.00
R0207:Smc1b	UTSW	15	85123759	missense	probably benign
R0390:Smc1b	UTSW	15	85066277	missense	probably damaging	1.00
R0440:Smc1b	UTSW	15	85112673	splice site	probably benign
R0685:Smc1b	UTSW	15	85070820	missense	possibly damaging	0.92
R1109:Smc1b	UTSW	15	85112815	missense	probably damaging	0.98
R1392:Smc1b	UTSW	15	85107070	splice site	probably benign
R1509:Smc1b	UTSW	15	85086134	missense	probably benign
R1804:Smc1b	UTSW	15	85127790	missense	possibly damaging	0.90
R1879:Smc1b	UTSW	15	85092067	missense	probably benign	0.01
R2086:Smc1b	UTSW	15	85121851	splice site	probably benign
R2143:Smc1b	UTSW	15	85123802	missense	probably benign
R2158:Smc1b	UTSW	15	85121851	splice site	probably benign
R2174:Smc1b	UTSW	15	85121851	splice site	probably benign
R2471:Smc1b	UTSW	15	85092017	missense	probably damaging	0.98
R3689:Smc1b	UTSW	15	85117263	intron	probably benign
R3690:Smc1b	UTSW	15	85117263	intron	probably benign
R4178:Smc1b	UTSW	15	85120647	missense	possibly damaging	0.94
R4420:Smc1b	UTSW	15	85112830	missense	probably damaging	1.00
R4905:Smc1b	UTSW	15	85066227	missense	probably damaging	1.00
R4919:Smc1b	UTSW	15	85117104	intron	probably benign
R5114:Smc1b	UTSW	15	85064984	missense	probably damaging	1.00
R5314:Smc1b	UTSW	15	85070865	missense	probably benign	0.00
R5476:Smc1b	UTSW	15	85086151	missense	probably damaging	0.97
R5593:Smc1b	UTSW	15	85121641	missense	probably benign	0.06
R5690:Smc1b	UTSW	15	85112773	missense	probably damaging	1.00
R5817:Smc1b	UTSW	15	85067783	missense	probably damaging	0.99
R5834:Smc1b	UTSW	15	85089665	missense	probably damaging	1.00
R5930:Smc1b	UTSW	15	85086121	missense	probably damaging	1.00
R6032:Smc1b	UTSW	15	85066229	missense	possibly damaging	0.92
R6032:Smc1b	UTSW	15	85066229	missense	possibly damaging	0.92
R6049:Smc1b	UTSW	15	85121695	missense	probably damaging	1.00
R6306:Smc1b	UTSW	15	85127623	missense	probably benign	0.30
R6392:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6426:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6435:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6436:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6437:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6508:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6512:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6703:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6737:Smc1b	UTSW	15	85092031	missense	probably benign	0.03
R6775:Smc1b	UTSW	15	85089680	missense	probably damaging	0.96
R6889:Smc1b	UTSW	15	85067759	missense	probably damaging	1.00
R6908:Smc1b	UTSW	15	85107010	missense	probably damaging	1.00
R7124:Smc1b	UTSW	15	85071597	missense	probably damaging	0.98
R7400:Smc1b	UTSW	15	85069720	missense	probably damaging	1.00
R7417:Smc1b	UTSW	15	85097542	missense	probably benign	0.05
R7610:Smc1b	UTSW	15	85070820	missense	possibly damaging	0.92
R7873:Smc1b	UTSW	15	85110650	critical splice donor site	probably null
R7890:Smc1b	UTSW	15	85066328	missense	probably damaging	1.00
R7956:Smc1b	UTSW	15	85110650	critical splice donor site	probably null
R7973:Smc1b	UTSW	15	85066328	missense	probably damaging	1.00
R8004:Smc1b	UTSW	15	85097614	missense	not run
Z1176:Smc1b	UTSW	15	85131903	missense	not run

Predicted Primers

PCR Primer
(F):5'- TTGAATATCAAACTAAGGCAGGGC -3'
(R):5'- CCTTTTGGCCTAACTCATGAAAATC -3'

Sequencing Primer
(F):5'- CCTATGTATGCAAGGCAAGTCTG -3'
(R):5'- GGCCTAACTCATGAAAATCTAAGAG -3'

Posted On

2017-01-03