Incidental Mutation 'R5720:Dhtkd1'
ID451396
Institutional Source Beutler Lab
Gene Symbol Dhtkd1
Ensembl Gene ENSMUSG00000025815
Gene Namedehydrogenase E1 and transketolase domain containing 1
SynonymsC330018I04Rik
MMRRC Submission 043188-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5720 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location5896115-5942792 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5903014 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 787 (T787A)
Ref Sequence ENSEMBL: ENSMUSP00000092769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026924] [ENSMUST00000095147]
Predicted Effect probably damaging
Transcript: ENSMUST00000026924
AA Change: T787A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026924
Gene: ENSMUSG00000025815
AA Change: T787A

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 150 165 N/A INTRINSIC
Pfam:E1_dh 193 505 2.4e-44 PFAM
Blast:Transket_pyr 523 558 9e-8 BLAST
Transket_pyr 570 773 2.1e-54 SMART
Blast:Transket_pyr 775 805 7e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000095147
AA Change: T787A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092769
Gene: ENSMUSG00000025815
AA Change: T787A

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 150 165 N/A INTRINSIC
Pfam:E1_dh 193 505 2.4e-44 PFAM
Blast:Transket_pyr 523 558 9e-8 BLAST
Transket_pyr 570 773 2.1e-54 SMART
Blast:Transket_pyr 775 805 7e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155977
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of a mitochondrial 2-oxoglutarate-dehydrogenase-complex-like protein involved in the degradation pathways of several amino acids, including lysine. Mutations in this gene are associated with 2-aminoadipic 2-oxoadipic aciduria and Charcot-Marie-Tooth Disease Type 2Q. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,203,687 N1165K probably benign Het
Arhgef10l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 4: 140,581,619 probably benign Het
BC037034 A G 5: 138,263,702 V44A probably benign Het
Cdh23 T C 10: 60,393,023 T1125A possibly damaging Het
Ctf1 A T 7: 127,717,002 probably null Het
Defb26 T C 2: 152,508,202 N53D possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxl7 A G 15: 26,552,893 L96P probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gpr65 A T 12: 98,275,102 S5C probably damaging Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Itga8 G A 2: 12,111,087 S76L probably damaging Het
Mpdz A T 4: 81,287,694 F1810Y probably damaging Het
Nfrkb T C 9: 31,394,742 L126P probably damaging Het
Olfr1250 T C 2: 89,656,955 Y162C probably benign Het
Primpol A G 8: 46,581,642 V417A probably damaging Het
Pus1 C T 5: 110,777,718 E79K probably damaging Het
Rspo2 C T 15: 43,169,814 C4Y probably benign Het
Serpina12 T C 12: 104,038,304 D23G probably benign Het
Serpind1 A T 16: 17,339,832 R297S probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc17a6 C T 7: 51,625,397 P68L probably damaging Het
Slc6a5 C T 7: 49,956,516 P724L possibly damaging Het
Spaca7 A G 8: 12,599,004 E166G possibly damaging Het
Supt5 A G 7: 28,322,568 S345P probably damaging Het
Syne2 G A 12: 75,967,667 D3211N probably benign Het
Tmem132e G A 11: 82,442,450 probably null Het
Zfp384 T C 6: 125,036,624 S536P probably benign Het
Other mutations in Dhtkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Dhtkd1 APN 2 5929657 missense probably damaging 1.00
IGL01544:Dhtkd1 APN 2 5913531 missense probably benign 0.00
IGL01724:Dhtkd1 APN 2 5914840 missense probably benign 0.00
IGL01726:Dhtkd1 APN 2 5942656 missense unknown
IGL02069:Dhtkd1 APN 2 5930934 nonsense probably null 0.00
IGL02476:Dhtkd1 APN 2 5930906 missense possibly damaging 0.89
IGL02662:Dhtkd1 APN 2 5899972 missense probably damaging 1.00
IGL02937:Dhtkd1 APN 2 5917905 missense possibly damaging 0.49
PIT4486001:Dhtkd1 UTSW 2 5899995 missense probably benign
R0277:Dhtkd1 UTSW 2 5914888 missense probably benign 0.00
R0323:Dhtkd1 UTSW 2 5914888 missense probably benign 0.00
R0373:Dhtkd1 UTSW 2 5911870 missense probably damaging 1.00
R0512:Dhtkd1 UTSW 2 5904091 missense probably damaging 1.00
R1497:Dhtkd1 UTSW 2 5904113 missense probably damaging 1.00
R1924:Dhtkd1 UTSW 2 5911933 missense probably damaging 1.00
R1943:Dhtkd1 UTSW 2 5932482 missense probably benign 0.11
R1976:Dhtkd1 UTSW 2 5902391 missense possibly damaging 0.95
R2057:Dhtkd1 UTSW 2 5942619 missense unknown
R5050:Dhtkd1 UTSW 2 5917689 missense probably benign 0.00
R5057:Dhtkd1 UTSW 2 5919513 missense probably damaging 1.00
R5133:Dhtkd1 UTSW 2 5904002 missense probably damaging 1.00
R5219:Dhtkd1 UTSW 2 5914816 missense probably benign 0.01
R5437:Dhtkd1 UTSW 2 5924119 missense probably benign 0.01
R5526:Dhtkd1 UTSW 2 5911851 missense probably damaging 1.00
R6006:Dhtkd1 UTSW 2 5904025 nonsense probably null
R6155:Dhtkd1 UTSW 2 5910359 missense probably null 1.00
R6675:Dhtkd1 UTSW 2 5904078 missense probably damaging 1.00
R6870:Dhtkd1 UTSW 2 5919437 splice site probably null
R6899:Dhtkd1 UTSW 2 5917965 missense possibly damaging 0.91
R7123:Dhtkd1 UTSW 2 5917780 missense probably damaging 0.99
R7131:Dhtkd1 UTSW 2 5904070 missense probably benign 0.23
R7366:Dhtkd1 UTSW 2 5917906 missense probably benign 0.01
R7568:Dhtkd1 UTSW 2 5922087 intron probably null
R7731:Dhtkd1 UTSW 2 5924112 missense probably benign 0.07
R7874:Dhtkd1 UTSW 2 5917674 missense possibly damaging 0.72
R7957:Dhtkd1 UTSW 2 5917674 missense possibly damaging 0.72
Z1088:Dhtkd1 UTSW 2 5911874 missense possibly damaging 0.84
Z1177:Dhtkd1 UTSW 2 5942628 missense unknown
Predicted Primers PCR Primer
(F):5'- GGTGCACACAGACTAACTCAAAGG -3'
(R):5'- TGTACAGACTGGGCAAACTC -3'

Sequencing Primer
(F):5'- GACTAACTCAAAGGTACTCATATGC -3'
(R):5'- GTACAGACTGGGCAAACTCTTATC -3'
Posted On2017-01-03