Incidental Mutation 'R5720:Slc6a5'
ID451407
Institutional Source Beutler Lab
Gene Symbol Slc6a5
Ensembl Gene ENSMUSG00000039728
Gene Namesolute carrier family 6 (neurotransmitter transporter, glycine), member 5
SynonymsGlyt2
MMRRC Submission 043188-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5720 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location49910146-49963856 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 49956516 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 724 (P724L)
Ref Sequence ENSEMBL: ENSMUSP00000146917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056442] [ENSMUST00000107605] [ENSMUST00000207753] [ENSMUST00000209172]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056442
AA Change: P724L

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058699
Gene: ENSMUSG00000039728
AA Change: P724L

DomainStartEndE-ValueType
Pfam:SNF 185 734 1.6e-218 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107605
AA Change: P724L

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103230
Gene: ENSMUSG00000039728
AA Change: P724L

DomainStartEndE-ValueType
Pfam:SNF 185 734 1.6e-218 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207753
AA Change: P724L

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000209172
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium- and chloride-dependent glycine neurotransmitter transporter. This integral membrane glycoprotein is responsible for the clearance of extracellular glycine during glycine-mediated neurotransmission. This protein is found in glycinergic axons and maintains a high presynaptic pool of neurotransmitter at glycinergic synapses. Mutations in this gene cause hyperekplexia; a heterogenous neurological disorder characterized by exaggerated startle responses and neonatal apnea. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutant mice appear normal at birth but develop a complex neuromotor phenotype involving tremors, rigidity, and an impaired righting ability. Mutant mice die approximately 2 weeks after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,203,687 N1165K probably benign Het
Arhgef10l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 4: 140,581,619 probably benign Het
BC037034 A G 5: 138,263,702 V44A probably benign Het
Cdh23 T C 10: 60,393,023 T1125A possibly damaging Het
Ctf1 A T 7: 127,717,002 probably null Het
Defb26 T C 2: 152,508,202 N53D possibly damaging Het
Dhtkd1 T C 2: 5,903,014 T787A probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxl7 A G 15: 26,552,893 L96P probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gpr65 A T 12: 98,275,102 S5C probably damaging Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Itga8 G A 2: 12,111,087 S76L probably damaging Het
Mpdz A T 4: 81,287,694 F1810Y probably damaging Het
Nfrkb T C 9: 31,394,742 L126P probably damaging Het
Olfr1250 T C 2: 89,656,955 Y162C probably benign Het
Primpol A G 8: 46,581,642 V417A probably damaging Het
Pus1 C T 5: 110,777,718 E79K probably damaging Het
Rspo2 C T 15: 43,169,814 C4Y probably benign Het
Serpina12 T C 12: 104,038,304 D23G probably benign Het
Serpind1 A T 16: 17,339,832 R297S probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc17a6 C T 7: 51,625,397 P68L probably damaging Het
Spaca7 A G 8: 12,599,004 E166G possibly damaging Het
Supt5 A G 7: 28,322,568 S345P probably damaging Het
Syne2 G A 12: 75,967,667 D3211N probably benign Het
Tmem132e G A 11: 82,442,450 probably null Het
Zfp384 T C 6: 125,036,624 S536P probably benign Het
Other mutations in Slc6a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Slc6a5 APN 7 49917733 missense probably benign 0.35
IGL01821:Slc6a5 APN 7 49914853 intron probably benign
R0084:Slc6a5 UTSW 7 49930013 missense probably benign 0.01
R0266:Slc6a5 UTSW 7 49938408 splice site probably benign
R0411:Slc6a5 UTSW 7 49911791 missense probably damaging 1.00
R0621:Slc6a5 UTSW 7 49917365 splice site probably null
R1649:Slc6a5 UTSW 7 49936262 missense probably damaging 1.00
R1822:Slc6a5 UTSW 7 49956425 missense probably benign 0.00
R1889:Slc6a5 UTSW 7 49951434 missense probably benign 0.03
R2084:Slc6a5 UTSW 7 49948254 missense probably benign 0.14
R2098:Slc6a5 UTSW 7 49945567 missense probably damaging 1.00
R2365:Slc6a5 UTSW 7 49946536 missense possibly damaging 0.93
R2516:Slc6a5 UTSW 7 49956462 missense probably benign 0.00
R3622:Slc6a5 UTSW 7 49917623 missense probably benign 0.16
R3752:Slc6a5 UTSW 7 49936314 critical splice donor site probably null
R3848:Slc6a5 UTSW 7 49927558 splice site probably benign
R3917:Slc6a5 UTSW 7 49911869 missense probably damaging 1.00
R4617:Slc6a5 UTSW 7 49912020 missense probably benign 0.00
R4663:Slc6a5 UTSW 7 49938398 nonsense probably null
R4757:Slc6a5 UTSW 7 49959282 missense probably benign 0.15
R4916:Slc6a5 UTSW 7 49948256 missense probably benign 0.00
R5183:Slc6a5 UTSW 7 49936209 missense probably damaging 0.97
R5257:Slc6a5 UTSW 7 49929992 missense probably damaging 0.98
R5512:Slc6a5 UTSW 7 49941825 missense probably damaging 1.00
R5537:Slc6a5 UTSW 7 49959311 missense probably benign 0.03
R5558:Slc6a5 UTSW 7 49927573 missense probably benign
R5627:Slc6a5 UTSW 7 49911774 missense possibly damaging 0.85
R5655:Slc6a5 UTSW 7 49956470 missense probably benign
R5736:Slc6a5 UTSW 7 49959354 missense probably benign 0.03
R5817:Slc6a5 UTSW 7 49956491 missense probably benign 0.00
R5879:Slc6a5 UTSW 7 49945512 missense probably damaging 1.00
R6033:Slc6a5 UTSW 7 49959351 missense probably benign 0.01
R6033:Slc6a5 UTSW 7 49959351 missense probably benign 0.01
R6072:Slc6a5 UTSW 7 49912195 missense probably damaging 1.00
R6157:Slc6a5 UTSW 7 49951502 missense probably benign 0.03
R6172:Slc6a5 UTSW 7 49948333 nonsense probably null
R6414:Slc6a5 UTSW 7 49910243 unclassified probably benign
R7348:Slc6a5 UTSW 7 49910167 unclassified probably benign
R7381:Slc6a5 UTSW 7 49930056 missense probably damaging 1.00
R7486:Slc6a5 UTSW 7 49917330 missense possibly damaging 0.81
R7624:Slc6a5 UTSW 7 49941866 missense probably benign 0.00
R7735:Slc6a5 UTSW 7 49948342 critical splice donor site probably null
R7760:Slc6a5 UTSW 7 49946617 missense probably benign 0.03
Z1088:Slc6a5 UTSW 7 49911857 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CCGTACGTGCGTGTTGAATG -3'
(R):5'- GCCTGATGATTGACTGGTCTC -3'

Sequencing Primer
(F):5'- CGTGTTGAATGAGTGAGTGAC -3'
(R):5'- TGGCAACTGGGATGACTTACTCAC -3'
Posted On2017-01-03