Mutagenetix > Incidental Mutation

Incidental Mutation 'R0551:Garnl3'

45142

Institutional Source

Beutler Lab

Gene Symbol

Garnl3

Ensembl Gene

ENSMUSG00000038860

Gene Name

GTPase activating RANGAP domain-like 3

Synonyms

MMRRC Submission

038743-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.138) question?

Stock #

R0551 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32986224-33131654 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 33016738 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 413 (S413P)

Ref Sequence

ENSEMBL: ENSMUSP00000099874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049618] [ENSMUST00000102810] [ENSMUST00000137381]

AlphaFold

Q3V0G7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000049618
AA Change: S417P

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000057582
Gene: ENSMUSG00000038860
AA Change: S417P

Domain	Start	End	E-Value	Type
Pfam:Rap_GAP	202	383	3.4e-73	PFAM
Pfam:CNH	475	780	3.5e-67	PFAM
low complexity region	793	804	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102810
AA Change: S413P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099874
Gene: ENSMUSG00000038860
AA Change: S413P

Domain	Start	End	E-Value	Type
Pfam:Rap_GAP	198	385	4.6e-67	PFAM
Pfam:CNH	471	776	1.8e-68	PFAM
low complexity region	789	800	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000137381
AA Change: S458P

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139778

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150242

Predicted Effect

probably benign
Transcript: ENSMUST00000193171

Meta Mutation Damage Score

0.0767

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 95.1%

Validation Efficiency

99% (77/78)

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	T	A	14: 32,662,641	T456S	probably benign	Het
5830473C10Rik	C	T	5: 90,572,719	P250S	probably damaging	Het
Acmsd	A	T	1: 127,766,333	K333N	probably benign	Het
Adcy2	T	A	13: 68,796,539	K241N	probably damaging	Het
Aebp1	A	G	11: 5,867,955	I77V	probably benign	Het
Ankrd35	A	G	3: 96,683,960	T521A	probably benign	Het
Arap2	C	T	5: 62,641,323		probably null	Het
Arfgap3	A	T	15: 83,343,137	C25S	probably damaging	Het
Arhgap20	T	A	9: 51,825,825		probably benign	Het
Arhgap39	C	T	15: 76,734,886	D833N	probably damaging	Het
Auts2	T	C	5: 131,440,469	E446G	possibly damaging	Het
Brwd1	C	T	16: 96,035,974	R886H	probably damaging	Het
Carm1	G	A	9: 21,580,491		probably null	Het
Cdc5l	G	A	17: 45,415,684	R321W	probably damaging	Het
Cfap54	A	T	10: 93,025,122	M841K	probably benign	Het
Clca4b	T	A	3: 144,928,626	T69S	probably damaging	Het
Cpox	A	G	16: 58,675,390	I357V	probably benign	Het
Diaph3	C	A	14: 86,910,100	V711L	probably benign	Het
Fabp3-ps1	T	C	10: 86,732,040		probably benign	Het
Fam120b	A	T	17: 15,431,643		probably benign	Het
Fcho1	A	G	8: 71,712,174	S488P	probably benign	Het
Flcn	A	G	11: 59,795,748		probably null	Het
Flt3l	A	G	7: 45,132,266	W234R	probably damaging	Het
Fzd7	G	T	1: 59,483,284	V109L	probably damaging	Het
G3bp1	A	G	11: 55,489,143	N101S	probably benign	Het
Gadd45g	A	G	13: 51,847,927	E143G	probably damaging	Het
Ganab	T	G	19: 8,907,280	I149S	probably benign	Het
Glis1	C	T	4: 107,568,119		probably null	Het
Gm11563	A	G	11: 99,658,713	S72P	unknown	Het
Gpd1	T	G	15: 99,720,629	I188S	possibly damaging	Het
Gria2	A	G	3: 80,732,026		probably benign	Het
H2afy2	A	G	10: 61,741,166	S308P	probably damaging	Het
Hpcal4	G	T	4: 123,189,055	A65S	possibly damaging	Het
Igsf10	G	A	3: 59,328,668	T1364I	probably benign	Het
Kdm4a	T	C	4: 118,138,231	*1065W	probably null	Het
Klkb1	A	G	8: 45,277,966		probably null	Het
Lipo3	T	C	19: 33,580,551	D147G	probably damaging	Het
Lrp1	A	G	10: 127,571,958	S1821P	probably benign	Het
Manba	T	C	3: 135,517,973	I207T	probably damaging	Het
Mark3	T	A	12: 111,633,634	S428T	probably benign	Het
Mfsd4a	G	A	1: 132,041,919	T348I	probably damaging	Het
Mfsd7a	A	G	5: 108,444,465		probably benign	Het
Mybbp1a	A	G	11: 72,448,376	M880V	probably benign	Het
N4bp2	T	A	5: 65,820,341		probably null	Het
Nrd1	T	G	4: 109,047,708	I712S	probably damaging	Het
Nup210	G	A	6: 91,021,484	R774C	possibly damaging	Het
Obscn	G	A	11: 59,107,862	R1395*	probably null	Het
Olfr1454	T	A	19: 13,064,294	D294E	probably benign	Het
Pcdh7	T	C	5: 57,721,994	Y964H	probably damaging	Het
Plin4	T	C	17: 56,106,756	T290A	probably benign	Het
Ppara	T	C	15: 85,787,105		probably benign	Het
Psg21	T	G	7: 18,652,640		probably null	Het
Ptar1	C	A	19: 23,720,340	N405K	probably benign	Het
Ralgps2	A	G	1: 156,832,663		probably null	Het
Rnf6	T	A	5: 146,211,395	N271I	possibly damaging	Het
Sis	T	C	3: 72,925,407	D1019G	possibly damaging	Het
Slc37a3	A	G	6: 39,352,754		probably benign	Het
Slc6a12	G	A	6: 121,356,918	V238I	probably damaging	Het
Sntg1	C	A	1: 8,554,736	V279L	possibly damaging	Het
Sorbs1	T	A	19: 40,311,816	E567D	probably damaging	Het
Sp110	C	A	1: 85,589,100		probably benign	Het
Ssu2	A	G	6: 112,380,554	V175A	possibly damaging	Het
Stk36	G	A	1: 74,616,621	E428K	probably benign	Het
Teddm1b	A	T	1: 153,875,344	I300F	possibly damaging	Het
Thy1	T	C	9: 44,047,348	V129A	probably damaging	Het
Tiam2	T	A	17: 3,428,954	M654K	probably damaging	Het
Tmem69	T	C	4: 116,553,273	S167G	probably benign	Het
Tmem8	C	A	17: 26,120,602	Q605K	probably damaging	Het
Tmem81	C	G	1: 132,507,829	I124M	probably damaging	Het
Tspan10	A	G	11: 120,444,418	D118G	probably damaging	Het
Tspo2	A	G	17: 48,448,813		probably benign	Het
Ttn	G	A	2: 76,908,328	Q4002*	probably null	Het
Tyro3	G	A	2: 119,816,904	R834Q	probably damaging	Het
Ugt2b1	T	C	5: 86,926,084	K139E	probably benign	Het
Vmn1r9	A	T	6: 57,071,539	I200F	probably benign	Het

Other mutations in Garnl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Garnl3	APN	2	33006816	missense	probably damaging	1.00
IGL01601:Garnl3	APN	2	32997689	nonsense	probably null
IGL01981:Garnl3	APN	2	32997729	missense	probably damaging	0.98
IGL02209:Garnl3	APN	2	33085930	missense	probably damaging	0.99
IGL02434:Garnl3	APN	2	33054205	missense	probably damaging	1.00
IGL02512:Garnl3	APN	2	33031138	missense	probably damaging	1.00
IGL02947:Garnl3	APN	2	33046594	missense	probably damaging	1.00
PIT4403001:Garnl3	UTSW	2	32990758	missense	probably damaging	1.00
R0123:Garnl3	UTSW	2	33006804	missense	possibly damaging	0.92
R0134:Garnl3	UTSW	2	33006804	missense	possibly damaging	0.92
R0225:Garnl3	UTSW	2	33006804	missense	possibly damaging	0.92
R0691:Garnl3	UTSW	2	33085907	missense	probably damaging	1.00
R0693:Garnl3	UTSW	2	33085907	missense	probably damaging	1.00
R0737:Garnl3	UTSW	2	32990642	missense	probably damaging	0.98
R1350:Garnl3	UTSW	2	33052214	missense	probably damaging	1.00
R1691:Garnl3	UTSW	2	32997663	nonsense	probably null
R1791:Garnl3	UTSW	2	33034127	missense	probably benign	0.02
R1938:Garnl3	UTSW	2	33005200	missense	probably damaging	0.99
R2100:Garnl3	UTSW	2	33046645	missense	probably benign	0.35
R2316:Garnl3	UTSW	2	33005152	missense	probably damaging	1.00
R2353:Garnl3	UTSW	2	33064034	missense	probably damaging	1.00
R3161:Garnl3	UTSW	2	33034711	missense	probably damaging	1.00
R3839:Garnl3	UTSW	2	32989546	missense	probably benign	0.00
R3847:Garnl3	UTSW	2	32992228	missense	probably benign
R4871:Garnl3	UTSW	2	33087088	start codon destroyed	probably null	0.77
R5682:Garnl3	UTSW	2	33054173	missense	probably damaging	1.00
R5811:Garnl3	UTSW	2	33006899	missense	probably damaging	0.99
R6267:Garnl3	UTSW	2	33104880	missense	probably benign	0.20
R6502:Garnl3	UTSW	2	33006821	missense	possibly damaging	0.67
R6532:Garnl3	UTSW	2	33031119	missense	possibly damaging	0.87
R6639:Garnl3	UTSW	2	32989525	missense	possibly damaging	0.75
R6763:Garnl3	UTSW	2	33054196	missense	probably damaging	1.00
R6866:Garnl3	UTSW	2	33002773	splice site	probably null
R6913:Garnl3	UTSW	2	32986829	missense	possibly damaging	0.91
R7002:Garnl3	UTSW	2	33054193	missense	possibly damaging	0.65
R7168:Garnl3	UTSW	2	32995078	missense	probably damaging	1.00
R7341:Garnl3	UTSW	2	33034129	missense	probably damaging	1.00
R7746:Garnl3	UTSW	2	32992257	missense	probably damaging	1.00
R7919:Garnl3	UTSW	2	33046599	missense	probably benign	0.38
R8079:Garnl3	UTSW	2	33018499	critical splice donor site	probably null
R8087:Garnl3	UTSW	2	33045536	missense	probably benign	0.01
R8123:Garnl3	UTSW	2	33104938	missense	probably damaging	0.97
R8170:Garnl3	UTSW	2	33015223	missense	possibly damaging	0.88
R8347:Garnl3	UTSW	2	33085891	missense	probably damaging	1.00
R8418:Garnl3	UTSW	2	33052146	missense	possibly damaging	0.73
R8679:Garnl3	UTSW	2	33026094	missense	probably damaging	1.00
R8940:Garnl3	UTSW	2	33005229	critical splice acceptor site	probably null
R9081:Garnl3	UTSW	2	33006908	missense	possibly damaging	0.90
R9183:Garnl3	UTSW	2	33005068	missense	probably damaging	1.00
R9213:Garnl3	UTSW	2	33005068	missense	probably damaging	1.00
R9219:Garnl3	UTSW	2	33085886	missense	probably damaging	1.00
R9453:Garnl3	UTSW	2	33003869	missense	probably damaging	1.00
X0022:Garnl3	UTSW	2	33022668	missense	probably damaging	1.00
X0023:Garnl3	UTSW	2	33026149	missense	probably damaging	1.00
X0024:Garnl3	UTSW	2	33005179	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGGATAGCAAGGAAAACACAGCCTC -3'
(R):5'- TGTGCAATGGGTGGCCTGGA -3'

Sequencing Primer
(F):5'- ctcacgcctttaatcccaac -3'
(R):5'- GTGTTCTCAGTCTTTACACAGTG -3'

Posted On

2013-06-11