Incidental Mutation 'R5720:Rspo2'
ID 451424
Institutional Source Beutler Lab
Gene Symbol Rspo2
Ensembl Gene ENSMUSG00000051920
Gene Name R-spondin 2
Synonyms 2610028F08Rik, ftls
MMRRC Submission 043188-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5720 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 43020794-43170826 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 43169814 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 4 (C4Y)
Ref Sequence ENSEMBL: ENSMUSP00000154600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063492] [ENSMUST00000226810]
AlphaFold Q8BFU0
Predicted Effect probably benign
Transcript: ENSMUST00000063492
AA Change: C4Y

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000067325
Gene: ENSMUSG00000051920
AA Change: C4Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FU 37 84 1.95e0 SMART
FU 90 134 3.7e-8 SMART
TSP1 147 204 7.45e-4 SMART
low complexity region 207 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226402
Predicted Effect probably benign
Transcript: ENSMUST00000226810
AA Change: C4Y

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R-spondin family of proteins. These proteins are secreted ligands of leucine-rich repeat containing G protein-coupled receptors that enhance Wnt signaling through the inhibition of ubiquitin E3 ligases. A chromosomal translocation including this locus that results in the formation of a gene fusion has been identified in multiple human cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mice display perinatal lethality, cleft palate, lung hypoplasia, asymmetric limb malformations and abnormal renal development. Heterozygous females display reduced fertility with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,203,687 N1165K probably benign Het
Arhgef10l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 4: 140,581,619 probably benign Het
BC037034 A G 5: 138,263,702 V44A probably benign Het
Cdh23 T C 10: 60,393,023 T1125A possibly damaging Het
Ctf1 A T 7: 127,717,002 probably null Het
Defb26 T C 2: 152,508,202 N53D possibly damaging Het
Dhtkd1 T C 2: 5,903,014 T787A probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxl7 A G 15: 26,552,893 L96P probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gpr65 A T 12: 98,275,102 S5C probably damaging Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Itga8 G A 2: 12,111,087 S76L probably damaging Het
Mpdz A T 4: 81,287,694 F1810Y probably damaging Het
Nfrkb T C 9: 31,394,742 L126P probably damaging Het
Olfr1250 T C 2: 89,656,955 Y162C probably benign Het
Primpol A G 8: 46,581,642 V417A probably damaging Het
Pus1 C T 5: 110,777,718 E79K probably damaging Het
Serpina12 T C 12: 104,038,304 D23G probably benign Het
Serpind1 A T 16: 17,339,832 R297S probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc17a6 C T 7: 51,625,397 P68L probably damaging Het
Slc6a5 C T 7: 49,956,516 P724L possibly damaging Het
Spaca7 A G 8: 12,599,004 E166G possibly damaging Het
Supt5 A G 7: 28,322,568 S345P probably damaging Het
Syne2 G A 12: 75,967,667 D3211N probably benign Het
Tmem132e G A 11: 82,442,450 probably null Het
Zfp384 T C 6: 125,036,624 S536P probably benign Het
Other mutations in Rspo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1505:Rspo2 UTSW 15 43075843 missense probably damaging 1.00
R1866:Rspo2 UTSW 15 43075936 missense probably damaging 1.00
R2913:Rspo2 UTSW 15 43078114 missense probably benign 0.00
R4082:Rspo2 UTSW 15 43022537 missense probably benign
R4256:Rspo2 UTSW 15 43075911 missense probably benign 0.43
R4257:Rspo2 UTSW 15 43075911 missense probably benign 0.43
R4422:Rspo2 UTSW 15 43169754 missense probably benign
R4715:Rspo2 UTSW 15 43075904 nonsense probably null
R4810:Rspo2 UTSW 15 43169820 missense probably benign 0.24
R4829:Rspo2 UTSW 15 43093187 nonsense probably null
R5828:Rspo2 UTSW 15 43075887 missense probably damaging 1.00
R7487:Rspo2 UTSW 15 43078114 missense probably benign 0.25
R7571:Rspo2 UTSW 15 43169976 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACCCTGAGAATGGTCAGTGG -3'
(R):5'- TGGAGGGAGAGATGCTCATC -3'

Sequencing Primer
(F):5'- CTGAGAATGGTCAGTGGTAGCCC -3'
(R):5'- TCGAGCCAAATTGATCATTGCAGC -3'
Posted On 2017-01-03