Incidental Mutation 'R5721:Faf1'
ID451434
Institutional Source Beutler Lab
Gene Symbol Faf1
Ensembl Gene ENSMUSG00000010517
Gene NameFas-associated factor 1
SynonymsDffrx, Fam
MMRRC Submission 043189-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5721 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location109676588-109963960 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109935666 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 612 (F612L)
Ref Sequence ENSEMBL: ENSMUSP00000099785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102724]
Predicted Effect probably benign
Transcript: ENSMUST00000102724
AA Change: F612L

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099785
Gene: ENSMUSG00000010517
AA Change: F612L

DomainStartEndE-ValueType
Pfam:UBA_4 8 43 2.5e-10 PFAM
low complexity region 68 82 N/A INTRINSIC
internal_repeat_1 109 155 3.24e-5 PROSPERO
low complexity region 174 180 N/A INTRINSIC
internal_repeat_1 204 250 3.24e-5 PROSPERO
UAS 335 480 3.79e-69 SMART
coiled coil region 496 560 N/A INTRINSIC
UBX 565 647 2.32e-33 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interaction of Fas ligand (TNFSF6) with the FAS antigen (TNFRSF6) mediates programmed cell death, also called apoptosis, in a number of organ systems. The protein encoded by this gene binds to FAS antigen and can initiate apoptosis or enhance apoptosis initiated through FAS antigen. Initiation of apoptosis by the protein encoded by this gene requires a ubiquitin-like domain but not the FAS-binding domain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous fail to develop beyond 2-cell stage. Mice homozygous for a hypomorphic gene trap allele exhibit decreased susceptibility to dopaminergic neuron neurotoxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,960,597 V30D probably damaging Het
Atl3 T A 19: 7,529,011 M302K probably benign Het
Ccdc91 C G 6: 147,575,503 L230V unknown Het
Ciz1 C T 2: 32,376,040 T39I probably damaging Het
Cog8 T C 8: 107,050,148 T532A probably benign Het
Ctsr C T 13: 61,161,853 G181S possibly damaging Het
Drc7 T C 8: 95,074,333 probably null Het
Dvl2 A G 11: 70,005,993 R238G possibly damaging Het
Fbxo40 T A 16: 36,968,934 M605L probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gprc6a A T 10: 51,614,980 M716K probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Jcad A T 18: 4,676,044 T1269S possibly damaging Het
Kif23 C G 9: 61,944,216 G66A probably benign Het
Lrrd1 T C 5: 3,850,619 M308T probably benign Het
Lsg1 C T 16: 30,561,775 A615T probably benign Het
Mcph1 G A 8: 18,671,207 V684M probably damaging Het
Mpv17l T C 16: 13,946,794 Y62H probably damaging Het
Olfr270 G T 4: 52,971,068 W149L probably damaging Het
Olfr713 T C 7: 107,036,358 S68P probably damaging Het
Osgepl1 A T 1: 53,321,200 M362L possibly damaging Het
P2ry14 T C 3: 59,115,031 probably null Het
Pacsin3 T A 2: 91,264,235 C402S probably damaging Het
Papss2 A G 19: 32,660,664 Y392C probably damaging Het
Plekha8 T A 6: 54,613,106 W19R probably damaging Het
Prdm15 A T 16: 97,807,096 I667N possibly damaging Het
Rab11fip2 A G 19: 59,935,610 S279P probably damaging Het
Slc6a20b C A 9: 123,611,989 G131C probably null Het
Suox T C 10: 128,671,293 I289V possibly damaging Het
Tbc1d16 C T 11: 119,158,730 probably null Het
Tmem269 T C 4: 119,209,949 T146A probably benign Het
Ttc30a1 A T 2: 75,981,371 Y123N probably damaging Het
Ttn G A 2: 76,728,567 R29657W probably damaging Het
Vmn1r84 C A 7: 12,362,226 C168F probably damaging Het
Zc3h7b T C 15: 81,773,298 F180L probably benign Het
Zfand4 C G 6: 116,287,995 D140E probably damaging Het
Other mutations in Faf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Faf1 APN 4 109840381 missense probably benign 0.10
IGL00569:Faf1 APN 4 109961880 makesense probably null
IGL01398:Faf1 APN 4 109736596 missense probably damaging 0.99
IGL01640:Faf1 APN 4 109840403 missense probably damaging 1.00
IGL01739:Faf1 APN 4 109677081 splice site probably benign
IGL02265:Faf1 APN 4 109742904 missense probably benign 0.00
IGL02372:Faf1 APN 4 109935582 missense probably benign 0.17
IGL02999:Faf1 APN 4 109861893 missense probably benign 0.01
R0058:Faf1 UTSW 4 109736624 missense probably benign 0.00
R0058:Faf1 UTSW 4 109736624 missense probably benign 0.00
R0098:Faf1 UTSW 4 109935499 missense probably damaging 0.99
R0098:Faf1 UTSW 4 109935499 missense probably damaging 0.99
R0183:Faf1 UTSW 4 109935610 missense probably benign
R0463:Faf1 UTSW 4 109890941 missense probably benign 0.02
R0505:Faf1 UTSW 4 109840403 missense possibly damaging 0.91
R0755:Faf1 UTSW 4 109961839 missense probably benign 0.00
R1705:Faf1 UTSW 4 109677002 start gained probably benign
R2061:Faf1 UTSW 4 109710808 missense probably damaging 1.00
R2132:Faf1 UTSW 4 109710845 missense probably damaging 1.00
R2133:Faf1 UTSW 4 109710845 missense probably damaging 1.00
R2696:Faf1 UTSW 4 109841328 missense possibly damaging 0.92
R3937:Faf1 UTSW 4 109757692 splice site probably benign
R3939:Faf1 UTSW 4 109861879 missense probably damaging 1.00
R4602:Faf1 UTSW 4 109727428 missense probably benign
R4727:Faf1 UTSW 4 109840367 missense probably damaging 0.96
R4860:Faf1 UTSW 4 109742896 missense probably damaging 0.99
R4860:Faf1 UTSW 4 109742896 missense probably damaging 0.99
R4896:Faf1 UTSW 4 109842299 missense probably benign 0.02
R4913:Faf1 UTSW 4 109935549 missense possibly damaging 0.96
R5688:Faf1 UTSW 4 109794813 missense probably damaging 1.00
R5905:Faf1 UTSW 4 109890929 missense probably benign 0.03
R6190:Faf1 UTSW 4 109861815 missense probably damaging 0.97
R6364:Faf1 UTSW 4 109961800 missense possibly damaging 0.46
R6454:Faf1 UTSW 4 109842334 missense probably benign 0.27
R6805:Faf1 UTSW 4 109861852 missense probably damaging 1.00
R7101:Faf1 UTSW 4 109925956 missense probably benign 0.12
R7381:Faf1 UTSW 4 109861937 missense probably damaging 0.99
R7392:Faf1 UTSW 4 109794843 missense probably benign 0.01
R7584:Faf1 UTSW 4 109925957 missense probably damaging 0.99
R7660:Faf1 UTSW 4 109861837 missense probably damaging 0.98
R7678:Faf1 UTSW 4 109829864 missense probably benign 0.00
R7715:Faf1 UTSW 4 109710814 missense probably damaging 0.99
R7721:Faf1 UTSW 4 109736597 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGCCCAATTTTATCTTCCTAGGC -3'
(R):5'- GAAATATCTGCTGGCCTGGG -3'

Sequencing Primer
(F):5'- AGGCCATCAGACTCTCCTTAG -3'
(R):5'- GGAAACCCAATCTCCATAAGCCAAG -3'
Posted On2017-01-03