Incidental Mutation 'R5721:Tmem269'
ID451435
Institutional Source Beutler Lab
Gene Symbol Tmem269
Ensembl Gene ENSMUSG00000028642
Gene Nametransmembrane protein 269
Synonyms4930538K18Rik
MMRRC Submission 043189-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R5721 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location119205055-119218217 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119209949 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 146 (T146A)
Ref Sequence ENSEMBL: ENSMUSP00000148286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030394] [ENSMUST00000212054]
Predicted Effect probably benign
Transcript: ENSMUST00000030394
AA Change: T94A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030394
Gene: ENSMUSG00000028642
AA Change: T94A

DomainStartEndE-ValueType
transmembrane domain 44 62 N/A INTRINSIC
transmembrane domain 69 88 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
transmembrane domain 169 191 N/A INTRINSIC
transmembrane domain 211 233 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132778
Predicted Effect probably benign
Transcript: ENSMUST00000212054
AA Change: T146A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,960,597 V30D probably damaging Het
Atl3 T A 19: 7,529,011 M302K probably benign Het
Ccdc91 C G 6: 147,575,503 L230V unknown Het
Ciz1 C T 2: 32,376,040 T39I probably damaging Het
Cog8 T C 8: 107,050,148 T532A probably benign Het
Ctsr C T 13: 61,161,853 G181S possibly damaging Het
Drc7 T C 8: 95,074,333 probably null Het
Dvl2 A G 11: 70,005,993 R238G possibly damaging Het
Faf1 T C 4: 109,935,666 F612L probably benign Het
Fbxo40 T A 16: 36,968,934 M605L probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gprc6a A T 10: 51,614,980 M716K probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Jcad A T 18: 4,676,044 T1269S possibly damaging Het
Kif23 C G 9: 61,944,216 G66A probably benign Het
Lrrd1 T C 5: 3,850,619 M308T probably benign Het
Lsg1 C T 16: 30,561,775 A615T probably benign Het
Mcph1 G A 8: 18,671,207 V684M probably damaging Het
Mpv17l T C 16: 13,946,794 Y62H probably damaging Het
Olfr270 G T 4: 52,971,068 W149L probably damaging Het
Olfr713 T C 7: 107,036,358 S68P probably damaging Het
Osgepl1 A T 1: 53,321,200 M362L possibly damaging Het
P2ry14 T C 3: 59,115,031 probably null Het
Pacsin3 T A 2: 91,264,235 C402S probably damaging Het
Papss2 A G 19: 32,660,664 Y392C probably damaging Het
Plekha8 T A 6: 54,613,106 W19R probably damaging Het
Prdm15 A T 16: 97,807,096 I667N possibly damaging Het
Rab11fip2 A G 19: 59,935,610 S279P probably damaging Het
Slc6a20b C A 9: 123,611,989 G131C probably null Het
Suox T C 10: 128,671,293 I289V possibly damaging Het
Tbc1d16 C T 11: 119,158,730 probably null Het
Ttc30a1 A T 2: 75,981,371 Y123N probably damaging Het
Ttn G A 2: 76,728,567 R29657W probably damaging Het
Vmn1r84 C A 7: 12,362,226 C168F probably damaging Het
Zc3h7b T C 15: 81,773,298 F180L probably benign Het
Zfand4 C G 6: 116,287,995 D140E probably damaging Het
Other mutations in Tmem269
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Tmem269 APN 4 119209314 missense probably benign 0.03
IGL02002:Tmem269 APN 4 119214141 missense probably benign
R1224:Tmem269 UTSW 4 119217126 missense probably benign 0.00
R1802:Tmem269 UTSW 4 119210873 critical splice donor site probably null
R4097:Tmem269 UTSW 4 119205780 missense probably damaging 0.98
R7053:Tmem269 UTSW 4 119209267 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGCTTCTCTTGTTTGGGGAAC -3'
(R):5'- CACACCTGTGCGTTAACCTTG -3'

Sequencing Primer
(F):5'- TGTGAAGCAAGGCTCCATAC -3'
(R):5'- GTTAACCTTGTCCTCCAAAGCAGG -3'
Posted On2017-01-03