Incidental Mutation 'R5721:Olfr713'
ID451442
Institutional Source Beutler Lab
Gene Symbol Olfr713
Ensembl Gene ENSMUSG00000073898
Gene Nameolfactory receptor 713
SynonymsGA_x6K02T2PBJ9-9415724-9416677, MOR263-1, P3
MMRRC Submission 043189-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5721 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location107031174-107040994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107036358 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 68 (S68P)
Ref Sequence ENSEMBL: ENSMUSP00000095741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098138] [ENSMUST00000098139] [ENSMUST00000213623]
Predicted Effect probably damaging
Transcript: ENSMUST00000098138
AA Change: S68P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095741
Gene: ENSMUSG00000073897
AA Change: S68P

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 2.6e-58 PFAM
Pfam:7tm_1 42 291 2.2e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098139
AA Change: S75P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095743
Gene: ENSMUSG00000073898
AA Change: S75P

DomainStartEndE-ValueType
Pfam:7tm_4 39 316 4.4e-57 PFAM
Pfam:7tm_1 49 298 2e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213623
AA Change: S68P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal olfactory sensory neuron projections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,960,597 V30D probably damaging Het
Atl3 T A 19: 7,529,011 M302K probably benign Het
Ccdc91 C G 6: 147,575,503 L230V unknown Het
Ciz1 C T 2: 32,376,040 T39I probably damaging Het
Cog8 T C 8: 107,050,148 T532A probably benign Het
Ctsr C T 13: 61,161,853 G181S possibly damaging Het
Drc7 T C 8: 95,074,333 probably null Het
Dvl2 A G 11: 70,005,993 R238G possibly damaging Het
Faf1 T C 4: 109,935,666 F612L probably benign Het
Fbxo40 T A 16: 36,968,934 M605L probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gprc6a A T 10: 51,614,980 M716K probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Jcad A T 18: 4,676,044 T1269S possibly damaging Het
Kif23 C G 9: 61,944,216 G66A probably benign Het
Lrrd1 T C 5: 3,850,619 M308T probably benign Het
Lsg1 C T 16: 30,561,775 A615T probably benign Het
Mcph1 G A 8: 18,671,207 V684M probably damaging Het
Mpv17l T C 16: 13,946,794 Y62H probably damaging Het
Olfr270 G T 4: 52,971,068 W149L probably damaging Het
Osgepl1 A T 1: 53,321,200 M362L possibly damaging Het
P2ry14 T C 3: 59,115,031 probably null Het
Pacsin3 T A 2: 91,264,235 C402S probably damaging Het
Papss2 A G 19: 32,660,664 Y392C probably damaging Het
Plekha8 T A 6: 54,613,106 W19R probably damaging Het
Prdm15 A T 16: 97,807,096 I667N possibly damaging Het
Rab11fip2 A G 19: 59,935,610 S279P probably damaging Het
Slc6a20b C A 9: 123,611,989 G131C probably null Het
Suox T C 10: 128,671,293 I289V possibly damaging Het
Tbc1d16 C T 11: 119,158,730 probably null Het
Tmem269 T C 4: 119,209,949 T146A probably benign Het
Ttc30a1 A T 2: 75,981,371 Y123N probably damaging Het
Ttn G A 2: 76,728,567 R29657W probably damaging Het
Vmn1r84 C A 7: 12,362,226 C168F probably damaging Het
Zc3h7b T C 15: 81,773,298 F180L probably benign Het
Zfand4 C G 6: 116,287,995 D140E probably damaging Het
Other mutations in Olfr713
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Olfr713 APN 7 107036847 missense probably damaging 0.99
IGL01630:Olfr713 APN 7 107037111 utr 3 prime probably benign
IGL02539:Olfr713 APN 7 107036434 missense probably damaging 1.00
IGL02727:Olfr713 APN 7 107036695 missense probably damaging 1.00
IGL03336:Olfr713 APN 7 107036335 missense probably damaging 1.00
R0501:Olfr713 UTSW 7 107036232 missense probably benign
R0684:Olfr713 UTSW 7 107036682 missense probably damaging 1.00
R0909:Olfr713 UTSW 7 107036194 missense probably benign 0.19
R1481:Olfr713 UTSW 7 107036149 missense probably benign 0.05
R1958:Olfr713 UTSW 7 107036271 missense possibly damaging 0.77
R1965:Olfr713 UTSW 7 107036358 missense probably damaging 1.00
R2119:Olfr713 UTSW 7 107036731 missense probably damaging 1.00
R2149:Olfr713 UTSW 7 107036338 missense possibly damaging 0.68
R3012:Olfr713 UTSW 7 107036362 missense possibly damaging 0.79
R3428:Olfr713 UTSW 7 107036716 missense probably benign
R4425:Olfr713 UTSW 7 107036491 missense probably damaging 1.00
R4795:Olfr713 UTSW 7 107036914 missense probably benign 0.00
R4796:Olfr713 UTSW 7 107036914 missense probably benign 0.00
R4908:Olfr713 UTSW 7 107036157 start codon destroyed probably benign 0.02
R4945:Olfr713 UTSW 7 107036319 missense probably benign 0.00
R5122:Olfr713 UTSW 7 107036848 nonsense probably null
R5979:Olfr713 UTSW 7 107036336 missense probably damaging 1.00
R6739:Olfr713 UTSW 7 107036811 missense probably damaging 1.00
R6981:Olfr713 UTSW 7 107036749 missense possibly damaging 0.77
R7197:Olfr713 UTSW 7 107036157 missense probably benign 0.03
R7228:Olfr713 UTSW 7 107037100 missense probably benign
R7444:Olfr713 UTSW 7 107036347 missense probably damaging 1.00
R8830:Olfr713 UTSW 7 107036682 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TATGCTCATTCCCATGGCTACAG -3'
(R):5'- ACTGCAGATGGCCACATAGC -3'

Sequencing Primer
(F):5'- TTCCCATGGCTACAGGAAAC -3'
(R):5'- CACATAGCGGTCATATGCCATGG -3'
Posted On2017-01-03