Incidental Mutation 'R5721:Gprc6a'
ID 451449
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene Name G protein-coupled receptor, family C, group 6, member A
Synonyms
MMRRC Submission 043189-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5721 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 51490919-51507554 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 51491076 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 716 (M716K)
Ref Sequence ENSEMBL: ENSMUSP00000152031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
AlphaFold Q8K4Z6
Predicted Effect probably benign
Transcript: ENSMUST00000020062
AA Change: M891K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: M891K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218684
AA Change: M716K

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000219286
AA Change: M820K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,844,798 (GRCm39) V30D probably damaging Het
Atl3 T A 19: 7,506,376 (GRCm39) M302K probably benign Het
Ccdc91 C G 6: 147,477,001 (GRCm39) L230V unknown Het
Ciz1 C T 2: 32,266,052 (GRCm39) T39I probably damaging Het
Cog8 T C 8: 107,776,780 (GRCm39) T532A probably benign Het
Ctsr C T 13: 61,309,667 (GRCm39) G181S possibly damaging Het
Drc7 T C 8: 95,800,961 (GRCm39) probably null Het
Dvl2 A G 11: 69,896,819 (GRCm39) R238G possibly damaging Het
Faf1 T C 4: 109,792,863 (GRCm39) F612L probably benign Het
Fbxo40 T A 16: 36,789,296 (GRCm39) M605L probably benign Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Greb1l G A 18: 10,542,427 (GRCm39) E1341K probably damaging Het
Ift70a1 A T 2: 75,811,715 (GRCm39) Y123N probably damaging Het
Jcad A T 18: 4,676,044 (GRCm39) T1269S possibly damaging Het
Kif23 C G 9: 61,851,498 (GRCm39) G66A probably benign Het
Lrrd1 T C 5: 3,900,619 (GRCm39) M308T probably benign Het
Lsg1 C T 16: 30,380,593 (GRCm39) A615T probably benign Het
Mcph1 G A 8: 18,721,223 (GRCm39) V684M probably damaging Het
Mpv17l T C 16: 13,764,658 (GRCm39) Y62H probably damaging Het
Or10a5 T C 7: 106,635,565 (GRCm39) S68P probably damaging Het
Or13d1 G T 4: 52,971,068 (GRCm39) W149L probably damaging Het
Osgepl1 A T 1: 53,360,359 (GRCm39) M362L possibly damaging Het
P2ry14 T C 3: 59,022,452 (GRCm39) probably null Het
Pacsin3 T A 2: 91,094,580 (GRCm39) C402S probably damaging Het
Papss2 A G 19: 32,638,064 (GRCm39) Y392C probably damaging Het
Plekha8 T A 6: 54,590,091 (GRCm39) W19R probably damaging Het
Prdm15 A T 16: 97,608,296 (GRCm39) I667N possibly damaging Het
Rab11fip2 A G 19: 59,924,042 (GRCm39) S279P probably damaging Het
Slc6a20b C A 9: 123,441,054 (GRCm39) G131C probably null Het
Suox T C 10: 128,507,162 (GRCm39) I289V possibly damaging Het
Tbc1d16 C T 11: 119,049,556 (GRCm39) probably null Het
Tmem269 T C 4: 119,067,146 (GRCm39) T146A probably benign Het
Ttn G A 2: 76,558,911 (GRCm39) R29657W probably damaging Het
Vmn1r84 C A 7: 12,096,153 (GRCm39) C168F probably damaging Het
Zc3h7b T C 15: 81,657,499 (GRCm39) F180L probably benign Het
Zfand4 C G 6: 116,264,956 (GRCm39) D140E probably damaging Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51,491,526 (GRCm39) missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51,503,180 (GRCm39) missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51,502,819 (GRCm39) missense probably benign
IGL02317:Gprc6a APN 10 51,497,049 (GRCm39) missense probably benign 0.01
IGL02995:Gprc6a APN 10 51,502,895 (GRCm39) missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51,492,699 (GRCm39) missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51,504,445 (GRCm39) missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51,491,968 (GRCm39) missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51,491,355 (GRCm39) missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51,504,533 (GRCm39) missense probably benign 0.01
R1831:Gprc6a UTSW 10 51,491,902 (GRCm39) missense probably benign 0.22
R2108:Gprc6a UTSW 10 51,491,304 (GRCm39) missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2160:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2162:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2229:Gprc6a UTSW 10 51,502,891 (GRCm39) missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51,504,392 (GRCm39) missense probably benign 0.02
R3709:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3710:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3737:Gprc6a UTSW 10 51,503,007 (GRCm39) missense probably benign
R3914:Gprc6a UTSW 10 51,504,371 (GRCm39) missense probably benign 0.00
R3918:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3964:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3965:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3966:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3973:Gprc6a UTSW 10 51,504,544 (GRCm39) missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3978:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3979:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R4306:Gprc6a UTSW 10 51,492,735 (GRCm39) missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4405:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4408:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4713:Gprc6a UTSW 10 51,507,553 (GRCm39) unclassified probably benign
R4788:Gprc6a UTSW 10 51,491,104 (GRCm39) missense probably benign 0.00
R5248:Gprc6a UTSW 10 51,491,089 (GRCm39) missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51,502,900 (GRCm39) missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51,502,798 (GRCm39) missense probably benign
R6061:Gprc6a UTSW 10 51,491,907 (GRCm39) missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51,491,173 (GRCm39) missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51,491,356 (GRCm39) missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51,491,008 (GRCm39) missense probably benign 0.44
R6207:Gprc6a UTSW 10 51,502,931 (GRCm39) missense probably benign 0.36
R6497:Gprc6a UTSW 10 51,491,797 (GRCm39) missense probably benign 0.05
R6717:Gprc6a UTSW 10 51,491,233 (GRCm39) missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51,507,412 (GRCm39) missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51,502,841 (GRCm39) nonsense probably null
R7000:Gprc6a UTSW 10 51,491,143 (GRCm39) missense probably benign 0.34
R7019:Gprc6a UTSW 10 51,507,508 (GRCm39) missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51,490,986 (GRCm39) missense probably benign
R7173:Gprc6a UTSW 10 51,504,595 (GRCm39) missense probably benign 0.01
R7579:Gprc6a UTSW 10 51,502,883 (GRCm39) missense probably benign
R7736:Gprc6a UTSW 10 51,491,549 (GRCm39) missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51,491,026 (GRCm39) missense probably benign 0.02
R8273:Gprc6a UTSW 10 51,507,370 (GRCm39) missense probably benign
R8329:Gprc6a UTSW 10 51,503,355 (GRCm39) nonsense probably null
R8517:Gprc6a UTSW 10 51,507,337 (GRCm39) missense probably benign 0.00
R8723:Gprc6a UTSW 10 51,491,518 (GRCm39) missense probably damaging 1.00
R8815:Gprc6a UTSW 10 51,497,079 (GRCm39) missense probably benign 0.00
R8829:Gprc6a UTSW 10 51,491,295 (GRCm39) missense probably damaging 0.99
R9151:Gprc6a UTSW 10 51,497,182 (GRCm39) missense possibly damaging 0.94
R9420:Gprc6a UTSW 10 51,491,506 (GRCm39) missense probably damaging 0.99
R9753:Gprc6a UTSW 10 51,504,364 (GRCm39) missense probably benign 0.20
R9766:Gprc6a UTSW 10 51,491,884 (GRCm39) missense probably damaging 1.00
R9790:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
R9791:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
Z1177:Gprc6a UTSW 10 51,491,305 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAGTGTTCAAGCAAATGGC -3'
(R):5'- GCCGTGGAGATTATAGTCATTCTG -3'

Sequencing Primer
(F):5'- GCTGGGAAAGTAAATACACAATTTGC -3'
(R):5'- GCTGTATATTCTTCCCCAAGTGC -3'
Posted On 2017-01-03