Mutagenetix > Incidental Mutation

Incidental Mutation 'R5732:Uggt1'

451467

Institutional Source

Beutler Lab

Gene Symbol

Uggt1

Ensembl Gene

ENSMUSG00000037470

Gene Name

UDP-glucose glycoprotein glucosyltransferase 1

Synonyms

Ugcgl1, C820010P03Rik, A930007H10Rik, 0910001L17Rik

MMRRC Submission

043347-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.452) question?

Stock #

R5732 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

36140027-36244720 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 36161771 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000037930 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046875] [ENSMUST00000173166] [ENSMUST00000174266]

AlphaFold

Q6P5E4

Predicted Effect

probably null
Transcript: ENSMUST00000046875

SMART Domains

Protein: ENSMUSP00000037930
Gene: ENSMUSG00000037470

Domain	Start	End	E-Value	Type
signal peptide	1	42	N/A	INTRINSIC
Pfam:UDP-g_GGTase	44	1222	N/A	PFAM
SCOP:d1ga8a_	1256	1521	3e-45	SMART
Blast:BROMO	1414	1453	3e-17	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173082

Predicted Effect

probably benign
Transcript: ENSMUST00000173166

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173999

Predicted Effect

probably benign
Transcript: ENSMUST00000174224

Predicted Effect

probably benign
Transcript: ENSMUST00000174266

SMART Domains

Protein: ENSMUSP00000134640
Gene: ENSMUSG00000037470

Domain	Start	End	E-Value	Type
signal peptide	1	42	N/A	INTRINSIC
low complexity region	88	97	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.8%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
PHENOTYPE: Heterozygous KO reduces susceptibility to and morbidity of RNA virus infection. Homozygous KO is embryonic lethal. The peptide is a folding sensor for glycoproteins in the ER. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaa1b	T	A	9: 119,148,394	M407L	possibly damaging	Het
Acsf2	T	C	11: 94,569,942		probably benign	Het
Apob	A	G	12: 8,010,353	D2945G	probably benign	Het
Atg2a	T	C	19: 6,257,460	Y1475H	probably damaging	Het
Capn5	A	G	7: 98,129,386	L342P	possibly damaging	Het
Ccdc152	A	G	15: 3,292,378		probably null	Het
Ccdc7b	A	G	8: 129,072,714	M91V	possibly damaging	Het
Cd3g	T	C	9: 44,973,631	E105G	possibly damaging	Het
Cdadc1	A	G	14: 59,596,911	L44P	probably damaging	Het
Cdh23	A	G	10: 60,331,317	V1852A	possibly damaging	Het
Cdx2	T	C	5: 147,302,023	Q252R	possibly damaging	Het
Cps1	A	T	1: 67,157,764	I325F	probably benign	Het
Dctn1	G	A	6: 83,197,949		probably null	Het
Dcun1d3	T	C	7: 119,858,033	K152R	probably benign	Het
Dhx35	G	A	2: 158,831,785	V379M	probably damaging	Het
Fam171a2	T	C	11: 102,439,981	E224G	possibly damaging	Het
Flt1	G	T	5: 147,634,483	Y671*	probably null	Het
Fndc3b	T	C	3: 27,461,773	Y628C	probably damaging	Het
Foxj3	A	T	4: 119,585,811	D144V	probably damaging	Het
Gp2	A	G	7: 119,449,108	V429A	probably damaging	Het
Hydin	T	A	8: 110,452,058	I1095N	probably benign	Het
Kat2a	A	G	11: 100,708,240	F571S	probably damaging	Het
Kcnq1	C	A	7: 143,148,756		probably benign	Het
Letm2	A	C	8: 25,587,325	S250A	possibly damaging	Het
Llgl1	T	C	11: 60,709,460	V545A	probably benign	Het
Lrfn3	T	C	7: 30,359,606	D398G	probably benign	Het
Lrig1	G	T	6: 94,699,539	C49*	probably null	Het
Mug1	A	G	6: 121,878,493	I929V	probably benign	Het
Naaa	G	A	5: 92,263,455	T291I	probably damaging	Het
Ndufaf1	G	A	2: 119,660,040	Q180*	probably null	Het
Nr3c1	A	T	18: 39,415,699	H741Q	probably damaging	Het
Nsun5	T	C	5: 135,371,350	L109P	probably damaging	Het
Pacsin3	A	G	2: 91,260,260	E18G	probably damaging	Het
Rpgr	G	A	X: 10,166,272	P857L	probably benign	Het
Siglec1	G	A	2: 131,074,268	T1254M	probably benign	Het
Slc35a4	A	T	18: 36,682,341	T75S	probably benign	Het
Slc52a2	T	C	15: 76,541,074	I434T	probably benign	Het
Slco2a1	C	T	9: 103,050,256	T116I	probably damaging	Het
Snrpd2	T	C	7: 19,152,613		probably null	Het
Tbc1d32	T	A	10: 56,088,393	L903F	probably damaging	Het
Tex10	G	T	4: 48,460,046	T435K	probably damaging	Het
Tmem266	T	C	9: 55,380,836	S66P	probably damaging	Het
Top2b	A	T	14: 16,400,106	E581D	possibly damaging	Het
Wdr47	T	A	3: 108,633,156	Y622*	probably null	Het
Zfp644	A	T	5: 106,637,123	H519Q	probably damaging	Het
Zfp687	T	C	3: 95,011,217	M415V	possibly damaging	Het

Other mutations in Uggt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Uggt1	APN	1	36179552	splice site	probably benign
IGL00817:Uggt1	APN	1	36185932	missense	probably benign	0.03
IGL01395:Uggt1	APN	1	36155077	missense	probably damaging	1.00
IGL01609:Uggt1	APN	1	36182474	missense	probably damaging	1.00
IGL01619:Uggt1	APN	1	36161694	missense	probably damaging	0.99
IGL02077:Uggt1	APN	1	36176794	missense	probably damaging	0.99
IGL02313:Uggt1	APN	1	36184484	missense	probably damaging	0.99
IGL02341:Uggt1	APN	1	36164519	makesense	probably null
IGL02346:Uggt1	APN	1	36179670	missense	probably benign	0.00
IGL02447:Uggt1	APN	1	36150142	missense	probably damaging	1.00
IGL02883:Uggt1	APN	1	36177615	missense	probably benign	0.03
IGL02930:Uggt1	APN	1	36157456	missense	probably benign	0.01
IGL03153:Uggt1	APN	1	36202818	missense	possibly damaging	0.94
IGL03162:Uggt1	APN	1	36207956	missense	probably damaging	1.00
IGL03170:Uggt1	APN	1	36163261	missense	probably damaging	1.00
IGL03266:Uggt1	APN	1	36150048	missense	probably damaging	1.00
K3955:Uggt1	UTSW	1	36162353	missense	probably benign	0.37
R0037:Uggt1	UTSW	1	36185932	missense	probably benign	0.03
R0037:Uggt1	UTSW	1	36185932	missense	probably benign	0.03
R0167:Uggt1	UTSW	1	36170197	critical splice donor site	probably null
R0373:Uggt1	UTSW	1	36179670	missense	probably benign	0.00
R0502:Uggt1	UTSW	1	36159946	missense	probably damaging	1.00
R0546:Uggt1	UTSW	1	36195971	missense	probably benign	0.00
R0610:Uggt1	UTSW	1	36165506	splice site	probably benign
R0671:Uggt1	UTSW	1	36155128	missense	probably damaging	1.00
R0760:Uggt1	UTSW	1	36161724	missense	possibly damaging	0.68
R0825:Uggt1	UTSW	1	36158143	missense	probably benign	0.01
R0827:Uggt1	UTSW	1	36156313	critical splice acceptor site	probably null
R0884:Uggt1	UTSW	1	36175078	missense	probably benign	0.00
R1112:Uggt1	UTSW	1	36173546	missense	possibly damaging	0.54
R1470:Uggt1	UTSW	1	36176796	missense	probably benign	0.13
R1470:Uggt1	UTSW	1	36176796	missense	probably benign	0.13
R1592:Uggt1	UTSW	1	36202858	missense	probably benign	0.04
R1730:Uggt1	UTSW	1	36221261	missense	probably benign	0.05
R1923:Uggt1	UTSW	1	36179613	missense	probably damaging	0.99
R1970:Uggt1	UTSW	1	36151781	missense	probably damaging	1.00
R2086:Uggt1	UTSW	1	36192414	missense	probably null	1.00
R2829:Uggt1	UTSW	1	36162294	missense	probably benign	0.38
R3431:Uggt1	UTSW	1	36210059	nonsense	probably null
R3432:Uggt1	UTSW	1	36210059	nonsense	probably null
R3725:Uggt1	UTSW	1	36182507	nonsense	probably null
R3880:Uggt1	UTSW	1	36176804	intron	probably benign
R4052:Uggt1	UTSW	1	36164489	missense	probably damaging	0.98
R4133:Uggt1	UTSW	1	36158159	missense	probably damaging	1.00
R4489:Uggt1	UTSW	1	36146668	nonsense	probably null
R4570:Uggt1	UTSW	1	36150073	missense	probably damaging	1.00
R4866:Uggt1	UTSW	1	36202855	nonsense	probably null
R4895:Uggt1	UTSW	1	36156264	missense	probably damaging	1.00
R4900:Uggt1	UTSW	1	36202855	nonsense	probably null
R5372:Uggt1	UTSW	1	36244060	splice site	probably benign
R5385:Uggt1	UTSW	1	36184412	missense	probably damaging	1.00
R5652:Uggt1	UTSW	1	36216153	nonsense	probably null
R5694:Uggt1	UTSW	1	36179656	missense	probably damaging	1.00
R5893:Uggt1	UTSW	1	36227628	splice site	probably null
R6191:Uggt1	UTSW	1	36162208	missense	probably damaging	0.98
R6247:Uggt1	UTSW	1	36163228	missense	probably damaging	1.00
R6259:Uggt1	UTSW	1	36234916	missense	probably benign	0.00
R6399:Uggt1	UTSW	1	36163366	missense	possibly damaging	0.90
R6439:Uggt1	UTSW	1	36174951	missense	possibly damaging	0.95
R6468:Uggt1	UTSW	1	36173450	missense	probably benign	0.00
R6788:Uggt1	UTSW	1	36230688	missense	probably benign	0.00
R7165:Uggt1	UTSW	1	36155107	missense	probably benign	0.41
R7255:Uggt1	UTSW	1	36146106	missense	probably damaging	1.00
R7273:Uggt1	UTSW	1	36162221	missense	probably damaging	0.99
R7469:Uggt1	UTSW	1	36151733	missense	probably damaging	1.00
R7490:Uggt1	UTSW	1	36164508	missense	probably benign	0.01
R7570:Uggt1	UTSW	1	36185838	missense	probably benign	0.09
R7612:Uggt1	UTSW	1	36163235	missense	probably damaging	0.99
R7759:Uggt1	UTSW	1	36146725	missense	possibly damaging	0.81
R7792:Uggt1	UTSW	1	36207984	missense	probably damaging	1.00
R7816:Uggt1	UTSW	1	36163315	missense	possibly damaging	0.95
R7858:Uggt1	UTSW	1	36156258	missense	probably damaging	1.00
R7887:Uggt1	UTSW	1	36208034	missense	probably damaging	0.99
R8040:Uggt1	UTSW	1	36211473	missense	possibly damaging	0.70
R8093:Uggt1	UTSW	1	36227485	missense	probably damaging	1.00
R8245:Uggt1	UTSW	1	36165564	missense	probably damaging	1.00
R8338:Uggt1	UTSW	1	36227521	missense	probably damaging	1.00
R8353:Uggt1	UTSW	1	36170296	critical splice acceptor site	probably null
R8442:Uggt1	UTSW	1	36173487	missense	probably damaging	0.99
R8519:Uggt1	UTSW	1	36176643	splice site	probably null
R8529:Uggt1	UTSW	1	36184432	missense	possibly damaging	0.85
R8730:Uggt1	UTSW	1	36197543	critical splice donor site	probably null
R8917:Uggt1	UTSW	1	36146654	missense
R8947:Uggt1	UTSW	1	36158148	missense	probably benign	0.12
R9240:Uggt1	UTSW	1	36182615	missense	possibly damaging	0.50
R9248:Uggt1	UTSW	1	36210022	missense	possibly damaging	0.80
R9401:Uggt1	UTSW	1	36216131	critical splice donor site	probably null
R9414:Uggt1	UTSW	1	36184426	missense	probably benign	0.01
R9416:Uggt1	UTSW	1	36164522	missense
R9441:Uggt1	UTSW	1	36221225	missense	probably benign	0.02
R9489:Uggt1	UTSW	1	36234805	critical splice donor site	probably null
R9563:Uggt1	UTSW	1	36165546	missense	possibly damaging	0.60
R9605:Uggt1	UTSW	1	36234805	critical splice donor site	probably null
X0022:Uggt1	UTSW	1	36165555	missense	possibly damaging	0.67
Z1088:Uggt1	UTSW	1	36174191	missense	probably damaging	1.00
Z1176:Uggt1	UTSW	1	36161695	missense	probably damaging	1.00
Z1177:Uggt1	UTSW	1	36155073	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- GACTATAACGCACGATGCCTGG -3'
(R):5'- GTGTAAAGTCCCTGCTTGCTC -3'

Sequencing Primer
(F):5'- ACGATGCCTGGGGTAAGC -3'
(R):5'- CTGCTTGCTCTCCGTGGAG -3'

Posted On

2017-01-03