Incidental Mutation 'R5732:Zfp687'
ID451473
Institutional Source Beutler Lab
Gene Symbol Zfp687
Ensembl Gene ENSMUSG00000019338
Gene Namezinc finger protein 687
Synonyms4931408L03Rik
MMRRC Submission 043347-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.675) question?
Stock #R5732 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95006590-95015448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95011217 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 415 (M415V)
Ref Sequence ENSEMBL: ENSMUSP00000123335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019482] [ENSMUST00000072287] [ENSMUST00000125476] [ENSMUST00000128438] [ENSMUST00000132195] [ENSMUST00000137799] [ENSMUST00000149747]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019482
AA Change: M415V

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000019482
Gene: ENSMUSG00000019338
AA Change: M415V

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 170 186 N/A INTRINSIC
low complexity region 296 306 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
ZnF_C2H2 533 553 4.74e1 SMART
ZnF_C2H2 561 585 1.43e1 SMART
low complexity region 615 634 N/A INTRINSIC
low complexity region 639 667 N/A INTRINSIC
ZnF_C2H2 673 693 7.37e1 SMART
ZnF_C2H2 705 727 1.99e0 SMART
ZnF_C2H2 733 757 3.38e1 SMART
ZnF_C2H2 764 787 2.67e-1 SMART
ZnF_C2H2 792 815 4.4e-2 SMART
ZnF_C2H2 827 849 7.67e-2 SMART
ZnF_C2H2 858 881 2.36e-2 SMART
low complexity region 884 898 N/A INTRINSIC
low complexity region 914 938 N/A INTRINSIC
ZnF_C2H2 964 987 4.05e-1 SMART
ZnF_C2H2 994 1017 1.38e-3 SMART
ZnF_C2H2 1024 1050 4.65e-1 SMART
low complexity region 1057 1075 N/A INTRINSIC
low complexity region 1100 1114 N/A INTRINSIC
ZnF_C2H2 1135 1158 4.98e-1 SMART
ZnF_C2H2 1200 1222 1.82e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072287
SMART Domains Protein: ENSMUSP00000072134
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
SCOP:d1e8xa1 140 231 5e-22 SMART
PI3Kc 545 799 6.47e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125476
SMART Domains Protein: ENSMUSP00000121965
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
SCOP:d1e8xa1 152 243 5e-22 SMART
PI3Kc 572 826 6.47e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128160
Predicted Effect probably benign
Transcript: ENSMUST00000128438
SMART Domains Protein: ENSMUSP00000119354
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132195
SMART Domains Protein: ENSMUSP00000117308
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 170 186 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133166
Predicted Effect possibly damaging
Transcript: ENSMUST00000137799
AA Change: M415V

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123335
Gene: ENSMUSG00000019338
AA Change: M415V

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 170 186 N/A INTRINSIC
low complexity region 296 306 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
ZnF_C2H2 533 553 4.74e1 SMART
ZnF_C2H2 561 585 1.43e1 SMART
low complexity region 615 634 N/A INTRINSIC
low complexity region 639 667 N/A INTRINSIC
ZnF_C2H2 673 693 7.37e1 SMART
ZnF_C2H2 705 727 1.99e0 SMART
ZnF_C2H2 733 757 3.38e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147022
Predicted Effect probably benign
Transcript: ENSMUST00000149747
SMART Domains Protein: ENSMUSP00000116053
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes C2H2 zinc finger protein. The encoded protein may play a role in bone differentiation and development. Mutations in this gene are the cause of Paget disease of bone-6. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T A 9: 119,148,394 M407L possibly damaging Het
Acsf2 T C 11: 94,569,942 probably benign Het
Apob A G 12: 8,010,353 D2945G probably benign Het
Atg2a T C 19: 6,257,460 Y1475H probably damaging Het
Capn5 A G 7: 98,129,386 L342P possibly damaging Het
Ccdc152 A G 15: 3,292,378 probably null Het
Ccdc7b A G 8: 129,072,714 M91V possibly damaging Het
Cd3g T C 9: 44,973,631 E105G possibly damaging Het
Cdadc1 A G 14: 59,596,911 L44P probably damaging Het
Cdh23 A G 10: 60,331,317 V1852A possibly damaging Het
Cdx2 T C 5: 147,302,023 Q252R possibly damaging Het
Cps1 A T 1: 67,157,764 I325F probably benign Het
Dctn1 G A 6: 83,197,949 probably null Het
Dcun1d3 T C 7: 119,858,033 K152R probably benign Het
Dhx35 G A 2: 158,831,785 V379M probably damaging Het
Fam171a2 T C 11: 102,439,981 E224G possibly damaging Het
Flt1 G T 5: 147,634,483 Y671* probably null Het
Fndc3b T C 3: 27,461,773 Y628C probably damaging Het
Foxj3 A T 4: 119,585,811 D144V probably damaging Het
Gp2 A G 7: 119,449,108 V429A probably damaging Het
Hydin T A 8: 110,452,058 I1095N probably benign Het
Kat2a A G 11: 100,708,240 F571S probably damaging Het
Kcnq1 C A 7: 143,148,756 probably benign Het
Letm2 A C 8: 25,587,325 S250A possibly damaging Het
Llgl1 T C 11: 60,709,460 V545A probably benign Het
Lrfn3 T C 7: 30,359,606 D398G probably benign Het
Lrig1 G T 6: 94,699,539 C49* probably null Het
Mug1 A G 6: 121,878,493 I929V probably benign Het
Naaa G A 5: 92,263,455 T291I probably damaging Het
Ndufaf1 G A 2: 119,660,040 Q180* probably null Het
Nr3c1 A T 18: 39,415,699 H741Q probably damaging Het
Nsun5 T C 5: 135,371,350 L109P probably damaging Het
Pacsin3 A G 2: 91,260,260 E18G probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Slc35a4 A T 18: 36,682,341 T75S probably benign Het
Slc52a2 T C 15: 76,541,074 I434T probably benign Het
Slco2a1 C T 9: 103,050,256 T116I probably damaging Het
Snrpd2 T C 7: 19,152,613 probably null Het
Tbc1d32 T A 10: 56,088,393 L903F probably damaging Het
Tex10 G T 4: 48,460,046 T435K probably damaging Het
Tmem266 T C 9: 55,380,836 S66P probably damaging Het
Top2b A T 14: 16,400,106 E581D possibly damaging Het
Uggt1 A T 1: 36,161,771 probably null Het
Wdr47 T A 3: 108,633,156 Y622* probably null Het
Zfp644 A T 5: 106,637,123 H519Q probably damaging Het
Other mutations in Zfp687
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Zfp687 APN 3 95012416 missense probably damaging 1.00
IGL00510:Zfp687 APN 3 95008447 missense probably damaging 1.00
IGL00824:Zfp687 APN 3 95009185 missense probably damaging 1.00
IGL01861:Zfp687 APN 3 95011860 missense probably damaging 1.00
IGL02167:Zfp687 APN 3 95010530 missense probably benign
IGL02169:Zfp687 APN 3 95011432 missense probably damaging 1.00
IGL02260:Zfp687 APN 3 95011264 missense possibly damaging 0.92
IGL02539:Zfp687 APN 3 95011062 missense probably damaging 0.99
IGL02710:Zfp687 APN 3 95008773 missense probably benign 0.01
IGL02891:Zfp687 APN 3 95011946 missense probably damaging 0.97
IGL03186:Zfp687 APN 3 95011094 missense probably benign
R0006:Zfp687 UTSW 3 95011456 missense probably damaging 0.99
R0006:Zfp687 UTSW 3 95011456 missense probably damaging 0.99
R0243:Zfp687 UTSW 3 95011553 missense probably damaging 0.99
R0556:Zfp687 UTSW 3 95010408 missense probably damaging 1.00
R1111:Zfp687 UTSW 3 95009512 missense probably damaging 1.00
R1170:Zfp687 UTSW 3 95008473 missense probably damaging 1.00
R1236:Zfp687 UTSW 3 95012044 missense probably benign 0.01
R1482:Zfp687 UTSW 3 95007533 missense probably damaging 1.00
R1711:Zfp687 UTSW 3 95011889 missense probably benign 0.00
R2255:Zfp687 UTSW 3 95010437 missense probably damaging 1.00
R3763:Zfp687 UTSW 3 95012080 missense probably damaging 1.00
R3848:Zfp687 UTSW 3 95007914 missense probably damaging 1.00
R3850:Zfp687 UTSW 3 95007914 missense probably damaging 1.00
R4424:Zfp687 UTSW 3 95009128 missense probably damaging 1.00
R4630:Zfp687 UTSW 3 95012488 splice site probably null
R4989:Zfp687 UTSW 3 95010386 missense probably damaging 1.00
R5119:Zfp687 UTSW 3 95011676 missense probably benign 0.28
R5134:Zfp687 UTSW 3 95010386 missense probably damaging 1.00
R5249:Zfp687 UTSW 3 95009466 missense probably damaging 1.00
R5408:Zfp687 UTSW 3 95009275 unclassified probably benign
R5454:Zfp687 UTSW 3 95009146 missense probably damaging 1.00
R5883:Zfp687 UTSW 3 95012044 missense probably benign 0.01
R6342:Zfp687 UTSW 3 95011877 missense probably benign 0.01
R6395:Zfp687 UTSW 3 95007738 missense possibly damaging 0.48
R6463:Zfp687 UTSW 3 95010784 missense probably damaging 1.00
R6575:Zfp687 UTSW 3 95008389 missense probably damaging 1.00
R6972:Zfp687 UTSW 3 95009377 missense possibly damaging 0.65
R6973:Zfp687 UTSW 3 95009377 missense possibly damaging 0.65
R7087:Zfp687 UTSW 3 95010213 missense probably benign 0.08
R7407:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7408:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7483:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7492:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7514:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTGTACCATCACCACTG -3'
(R):5'- CACAAGAACTGTAACCCGGG -3'

Sequencing Primer
(F):5'- ACTGAGGCACCATTTACCTTCTG -3'
(R):5'- AACTGTAACCCGGGTCCCC -3'
Posted On2017-01-03