Incidental Mutation 'R5732:Nsun5'
ID451481
Institutional Source Beutler Lab
Gene Symbol Nsun5
Ensembl Gene ENSMUSG00000000916
Gene NameNOL1/NOP2/Sun domain family, member 5
Synonyms9830109N13Rik, Nol1r, Wbscr20a
MMRRC Submission 043347-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5732 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location135369953-135376805 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135371350 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 109 (L109P)
Ref Sequence ENSEMBL: ENSMUSP00000000940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000940] [ENSMUST00000065785] [ENSMUST00000111171] [ENSMUST00000111180] [ENSMUST00000170342]
Predicted Effect probably damaging
Transcript: ENSMUST00000000940
AA Change: L109P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000940
Gene: ENSMUSG00000000916
AA Change: L109P

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 180 189 N/A INTRINSIC
Pfam:Nol1_Nop2_Fmu 219 423 1.1e-32 PFAM
low complexity region 448 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065785
SMART Domains Protein: ENSMUSP00000066662
Gene: ENSMUSG00000053388

DomainStartEndE-ValueType
RING 16 56 7.92e-8 SMART
BBOX 84 125 3.34e-6 SMART
coiled coil region 128 163 N/A INTRINSIC
coiled coil region 206 235 N/A INTRINSIC
PRY 292 344 1.07e-13 SMART
SPRY 345 473 7.48e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111171
SMART Domains Protein: ENSMUSP00000106801
Gene: ENSMUSG00000053293

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
low complexity region 147 165 N/A INTRINSIC
low complexity region 174 188 N/A INTRINSIC
Pfam:POM121 292 527 1.3e-111 PFAM
low complexity region 541 551 N/A INTRINSIC
low complexity region 552 576 N/A INTRINSIC
low complexity region 581 602 N/A INTRINSIC
low complexity region 605 621 N/A INTRINSIC
low complexity region 658 674 N/A INTRINSIC
low complexity region 681 699 N/A INTRINSIC
low complexity region 715 742 N/A INTRINSIC
low complexity region 767 776 N/A INTRINSIC
low complexity region 782 800 N/A INTRINSIC
low complexity region 809 825 N/A INTRINSIC
internal_repeat_4 827 861 8.15e-5 PROSPERO
low complexity region 874 904 N/A INTRINSIC
internal_repeat_3 905 952 5.01e-5 PROSPERO
internal_repeat_1 917 961 1.66e-6 PROSPERO
low complexity region 963 979 N/A INTRINSIC
low complexity region 1002 1048 N/A INTRINSIC
low complexity region 1050 1099 N/A INTRINSIC
internal_repeat_2 1104 1144 4.39e-6 PROSPERO
internal_repeat_1 1114 1155 1.66e-6 PROSPERO
internal_repeat_4 1125 1164 8.15e-5 PROSPERO
internal_repeat_3 1126 1175 5.01e-5 PROSPERO
internal_repeat_2 1142 1178 4.39e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000111180
SMART Domains Protein: ENSMUSP00000106811
Gene: ENSMUSG00000053388

DomainStartEndE-ValueType
RING 16 56 7.92e-8 SMART
BBOX 84 125 3.34e-6 SMART
coiled coil region 128 163 N/A INTRINSIC
coiled coil region 206 235 N/A INTRINSIC
PRY 293 345 1.07e-13 SMART
SPRY 346 474 7.48e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141867
Predicted Effect probably benign
Transcript: ENSMUST00000170342
SMART Domains Protein: ENSMUSP00000128370
Gene: ENSMUSG00000000916

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 76 91 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000202422
AA Change: L106P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202792
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of an evolutionarily conserved family of proteins that may function as methyltransferases. This gene is located in a larger region of chromosome 7 that is deleted in Williams-Beuren syndrome, a multisystem developmental disorder. There are two pseudogenes for this gene located in the same region of chromosome 7. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T A 9: 119,148,394 M407L possibly damaging Het
Acsf2 T C 11: 94,569,942 probably benign Het
Apob A G 12: 8,010,353 D2945G probably benign Het
Atg2a T C 19: 6,257,460 Y1475H probably damaging Het
Capn5 A G 7: 98,129,386 L342P possibly damaging Het
Ccdc152 A G 15: 3,292,378 probably null Het
Ccdc7b A G 8: 129,072,714 M91V possibly damaging Het
Cd3g T C 9: 44,973,631 E105G possibly damaging Het
Cdadc1 A G 14: 59,596,911 L44P probably damaging Het
Cdh23 A G 10: 60,331,317 V1852A possibly damaging Het
Cdx2 T C 5: 147,302,023 Q252R possibly damaging Het
Cps1 A T 1: 67,157,764 I325F probably benign Het
Dctn1 G A 6: 83,197,949 probably null Het
Dcun1d3 T C 7: 119,858,033 K152R probably benign Het
Dhx35 G A 2: 158,831,785 V379M probably damaging Het
Fam171a2 T C 11: 102,439,981 E224G possibly damaging Het
Flt1 G T 5: 147,634,483 Y671* probably null Het
Fndc3b T C 3: 27,461,773 Y628C probably damaging Het
Foxj3 A T 4: 119,585,811 D144V probably damaging Het
Gp2 A G 7: 119,449,108 V429A probably damaging Het
Hydin T A 8: 110,452,058 I1095N probably benign Het
Kat2a A G 11: 100,708,240 F571S probably damaging Het
Kcnq1 C A 7: 143,148,756 probably benign Het
Letm2 A C 8: 25,587,325 S250A possibly damaging Het
Llgl1 T C 11: 60,709,460 V545A probably benign Het
Lrfn3 T C 7: 30,359,606 D398G probably benign Het
Lrig1 G T 6: 94,699,539 C49* probably null Het
Mug1 A G 6: 121,878,493 I929V probably benign Het
Naaa G A 5: 92,263,455 T291I probably damaging Het
Ndufaf1 G A 2: 119,660,040 Q180* probably null Het
Nr3c1 A T 18: 39,415,699 H741Q probably damaging Het
Pacsin3 A G 2: 91,260,260 E18G probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Slc35a4 A T 18: 36,682,341 T75S probably benign Het
Slc52a2 T C 15: 76,541,074 I434T probably benign Het
Slco2a1 C T 9: 103,050,256 T116I probably damaging Het
Snrpd2 T C 7: 19,152,613 probably null Het
Tbc1d32 T A 10: 56,088,393 L903F probably damaging Het
Tex10 G T 4: 48,460,046 T435K probably damaging Het
Tmem266 T C 9: 55,380,836 S66P probably damaging Het
Top2b A T 14: 16,400,106 E581D possibly damaging Het
Uggt1 A T 1: 36,161,771 probably null Het
Wdr47 T A 3: 108,633,156 Y622* probably null Het
Zfp644 A T 5: 106,637,123 H519Q probably damaging Het
Zfp687 T C 3: 95,011,217 M415V possibly damaging Het
Other mutations in Nsun5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Nsun5 APN 5 135375395 missense possibly damaging 0.69
IGL01797:Nsun5 APN 5 135375371 missense probably damaging 1.00
IGL01817:Nsun5 APN 5 135370039 missense probably damaging 1.00
IGL03233:Nsun5 APN 5 135375445 missense probably damaging 1.00
eastern UTSW 5 135375058 missense probably damaging 1.00
tropical UTSW 5 135375463 nonsense probably null
PIT4382001:Nsun5 UTSW 5 135371501 missense probably benign
R1436:Nsun5 UTSW 5 135370213 missense probably damaging 1.00
R1710:Nsun5 UTSW 5 135371316 missense probably damaging 1.00
R1919:Nsun5 UTSW 5 135375598 missense probably benign 0.00
R2067:Nsun5 UTSW 5 135375072 missense probably damaging 1.00
R2937:Nsun5 UTSW 5 135375463 nonsense probably null
R2938:Nsun5 UTSW 5 135375463 nonsense probably null
R4277:Nsun5 UTSW 5 135370060 missense probably damaging 1.00
R4278:Nsun5 UTSW 5 135370060 missense probably damaging 1.00
R6261:Nsun5 UTSW 5 135371531 missense probably damaging 1.00
R6525:Nsun5 UTSW 5 135375058 missense probably damaging 1.00
R6922:Nsun5 UTSW 5 135370192 missense probably damaging 0.98
R7110:Nsun5 UTSW 5 135371250 missense probably damaging 1.00
R7977:Nsun5 UTSW 5 135375680 missense probably damaging 1.00
R7987:Nsun5 UTSW 5 135375680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATCTGGACAGGTACCTACTTC -3'
(R):5'- ATAATCGATTGCATCCTCAGGGC -3'

Sequencing Primer
(F):5'- GGACAGGTACCTACTTCTCCCAC -3'
(R):5'- GGTCTTGAGCGTGTTCACAC -3'
Posted On2017-01-03