Incidental Mutation 'R0551:Manba'
ID 45149
Institutional Source Beutler Lab
Gene Symbol Manba
Ensembl Gene ENSMUSG00000028164
Gene Name mannosidase, beta A, lysosomal
Synonyms B930014J03Rik, Bmn, 2410030O07Rik
MMRRC Submission 038743-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R0551 (G1)
Quality Score 195
Status Validated
Chromosome 3
Chromosomal Location 135485611-135571404 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 135517973 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 207 (I207T)
Ref Sequence ENSEMBL: ENSMUSP00000029814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029814] [ENSMUST00000131610]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000029814
AA Change: I207T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029814
Gene: ENSMUSG00000028164
AA Change: I207T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_hydro_2_N 42 211 6.5e-11 PFAM
Pfam:Glyco_hydro_2_C 340 595 3.8e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123061
Predicted Effect probably benign
Transcript: ENSMUST00000131610
SMART Domains Protein: ENSMUSP00000122148
Gene: ENSMUSG00000028164

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_hydro_2_N 22 163 1.8e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140893
Meta Mutation Damage Score 0.5348 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyl hydrolase 2 family. The encoded protein localizes to the lysosome where it is the final exoglycosidase in the pathway for N-linked glycoprotein oligosaccharide catabolism. Mutations in this gene are associated with beta-mannosidosis, a lysosomal storage disease that has a wide spectrum of neurological involvement. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation results in no dysmorphology or overt neurological problems. Homozygotes show no beta-mannosidase activity and display consistent cytoplasmic vacuolation in the central nervous system and minimal vacuolation in most visceral organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,662,641 T456S probably benign Het
5830473C10Rik C T 5: 90,572,719 P250S probably damaging Het
Acmsd A T 1: 127,766,333 K333N probably benign Het
Adcy2 T A 13: 68,796,539 K241N probably damaging Het
Aebp1 A G 11: 5,867,955 I77V probably benign Het
Ankrd35 A G 3: 96,683,960 T521A probably benign Het
Arap2 C T 5: 62,641,323 probably null Het
Arfgap3 A T 15: 83,343,137 C25S probably damaging Het
Arhgap20 T A 9: 51,825,825 probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
Auts2 T C 5: 131,440,469 E446G possibly damaging Het
Brwd1 C T 16: 96,035,974 R886H probably damaging Het
Carm1 G A 9: 21,580,491 probably null Het
Cdc5l G A 17: 45,415,684 R321W probably damaging Het
Cfap54 A T 10: 93,025,122 M841K probably benign Het
Clca4b T A 3: 144,928,626 T69S probably damaging Het
Cpox A G 16: 58,675,390 I357V probably benign Het
Diaph3 C A 14: 86,910,100 V711L probably benign Het
Fabp3-ps1 T C 10: 86,732,040 probably benign Het
Fam120b A T 17: 15,431,643 probably benign Het
Fcho1 A G 8: 71,712,174 S488P probably benign Het
Flcn A G 11: 59,795,748 probably null Het
Flt3l A G 7: 45,132,266 W234R probably damaging Het
Fzd7 G T 1: 59,483,284 V109L probably damaging Het
G3bp1 A G 11: 55,489,143 N101S probably benign Het
Gadd45g A G 13: 51,847,927 E143G probably damaging Het
Ganab T G 19: 8,907,280 I149S probably benign Het
Garnl3 A G 2: 33,016,738 S413P probably damaging Het
Glis1 C T 4: 107,568,119 probably null Het
Gm11563 A G 11: 99,658,713 S72P unknown Het
Gpd1 T G 15: 99,720,629 I188S possibly damaging Het
Gria2 A G 3: 80,732,026 probably benign Het
H2afy2 A G 10: 61,741,166 S308P probably damaging Het
Hpcal4 G T 4: 123,189,055 A65S possibly damaging Het
Igsf10 G A 3: 59,328,668 T1364I probably benign Het
Kdm4a T C 4: 118,138,231 *1065W probably null Het
Klkb1 A G 8: 45,277,966 probably null Het
Lipo3 T C 19: 33,580,551 D147G probably damaging Het
Lrp1 A G 10: 127,571,958 S1821P probably benign Het
Mark3 T A 12: 111,633,634 S428T probably benign Het
Mfsd4a G A 1: 132,041,919 T348I probably damaging Het
Mfsd7a A G 5: 108,444,465 probably benign Het
Mybbp1a A G 11: 72,448,376 M880V probably benign Het
N4bp2 T A 5: 65,820,341 probably null Het
Nrd1 T G 4: 109,047,708 I712S probably damaging Het
Nup210 G A 6: 91,021,484 R774C possibly damaging Het
Obscn G A 11: 59,107,862 R1395* probably null Het
Olfr1454 T A 19: 13,064,294 D294E probably benign Het
Pcdh7 T C 5: 57,721,994 Y964H probably damaging Het
Plin4 T C 17: 56,106,756 T290A probably benign Het
Ppara T C 15: 85,787,105 probably benign Het
Psg21 T G 7: 18,652,640 probably null Het
Ptar1 C A 19: 23,720,340 N405K probably benign Het
Ralgps2 A G 1: 156,832,663 probably null Het
Rnf6 T A 5: 146,211,395 N271I possibly damaging Het
Sis T C 3: 72,925,407 D1019G possibly damaging Het
Slc37a3 A G 6: 39,352,754 probably benign Het
Slc6a12 G A 6: 121,356,918 V238I probably damaging Het
Sntg1 C A 1: 8,554,736 V279L possibly damaging Het
Sorbs1 T A 19: 40,311,816 E567D probably damaging Het
Sp110 C A 1: 85,589,100 probably benign Het
Ssu2 A G 6: 112,380,554 V175A possibly damaging Het
Stk36 G A 1: 74,616,621 E428K probably benign Het
Teddm1b A T 1: 153,875,344 I300F possibly damaging Het
Thy1 T C 9: 44,047,348 V129A probably damaging Het
Tiam2 T A 17: 3,428,954 M654K probably damaging Het
Tmem69 T C 4: 116,553,273 S167G probably benign Het
Tmem8 C A 17: 26,120,602 Q605K probably damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tspan10 A G 11: 120,444,418 D118G probably damaging Het
Tspo2 A G 17: 48,448,813 probably benign Het
Ttn G A 2: 76,908,328 Q4002* probably null Het
Tyro3 G A 2: 119,816,904 R834Q probably damaging Het
Ugt2b1 T C 5: 86,926,084 K139E probably benign Het
Vmn1r9 A T 6: 57,071,539 I200F probably benign Het
Other mutations in Manba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Manba APN 3 135554780 nonsense probably null
IGL01443:Manba APN 3 135544828 missense probably damaging 1.00
IGL01796:Manba APN 3 135542389 missense probably damaging 1.00
IGL02396:Manba APN 3 135544764 missense probably damaging 1.00
IGL02471:Manba APN 3 135507008 splice site probably benign
IGL02809:Manba APN 3 135547560 missense probably damaging 1.00
IGL02861:Manba APN 3 135570263 missense probably benign 0.03
IGL02934:Manba APN 3 135544749 missense probably benign 0.00
IGL03130:Manba APN 3 135551159 missense probably damaging 1.00
IGL03237:Manba APN 3 135544751 missense probably damaging 1.00
IGL03342:Manba APN 3 135517987 missense possibly damaging 0.51
R1549:Manba UTSW 3 135544806 missense probably damaging 1.00
R1752:Manba UTSW 3 135506945 missense probably damaging 1.00
R1932:Manba UTSW 3 135544740 missense probably benign 0.01
R1991:Manba UTSW 3 135551191 missense probably benign 0.05
R3729:Manba UTSW 3 135554850 missense probably benign 0.00
R3731:Manba UTSW 3 135554850 missense probably benign 0.00
R3813:Manba UTSW 3 135563262 missense possibly damaging 0.67
R4712:Manba UTSW 3 135544814 missense probably damaging 1.00
R5001:Manba UTSW 3 135567630 missense probably benign 0.00
R5481:Manba UTSW 3 135524556 missense possibly damaging 0.86
R5889:Manba UTSW 3 135524598 nonsense probably null
R6033:Manba UTSW 3 135549261 missense probably benign 0.00
R6033:Manba UTSW 3 135549261 missense probably benign 0.00
R6434:Manba UTSW 3 135511973 splice site probably null
R6760:Manba UTSW 3 135542451 missense probably damaging 0.98
R7164:Manba UTSW 3 135542388 missense probably damaging 1.00
R7182:Manba UTSW 3 135567513 missense probably benign 0.06
R7184:Manba UTSW 3 135523154 missense possibly damaging 0.62
R7212:Manba UTSW 3 135567635 missense probably benign
R7266:Manba UTSW 3 135517912 missense probably damaging 1.00
R7271:Manba UTSW 3 135542376 missense probably damaging 1.00
R7466:Manba UTSW 3 135542393 missense probably benign 0.13
R7467:Manba UTSW 3 135544801 missense probably damaging 1.00
R7542:Manba UTSW 3 135566593 missense probably benign 0.10
R7546:Manba UTSW 3 135570246 missense probably benign 0.01
R7726:Manba UTSW 3 135518009 missense probably benign 0.14
R8475:Manba UTSW 3 135511812 missense probably benign 0.13
R8768:Manba UTSW 3 135551234 missense probably damaging 1.00
R8856:Manba UTSW 3 135518003 missense probably damaging 0.98
R9140:Manba UTSW 3 135485729 missense probably benign
R9449:Manba UTSW 3 135549318 missense probably benign 0.01
Z1176:Manba UTSW 3 135563274 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGACAGCAGTGGAAGGGATGAGGA -3'
(R):5'- GGGGAGGGAGCATGAGTGAAAGGAA -3'

Sequencing Primer
(F):5'- cccgctgagctatctctcc -3'
(R):5'- cctctctctttctttcttcctttc -3'
Posted On 2013-06-11