Incidental Mutation 'R5732:Capn5'
ID451490
Institutional Source Beutler Lab
Gene Symbol Capn5
Ensembl Gene ENSMUSG00000035547
Gene Namecalpain 5
Synonyms
MMRRC Submission 043347-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R5732 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location98121559-98178274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98129386 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 342 (L342P)
Ref Sequence ENSEMBL: ENSMUSP00000102729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040971] [ENSMUST00000107112]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040971
AA Change: L342P

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048183
Gene: ENSMUSG00000035547
AA Change: L342P

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107112
AA Change: L342P

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102729
Gene: ENSMUSG00000035547
AA Change: L342P

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the calpain family of proteins. Unlike many members of the calpain gene family, this gene lacks a calmodulin-like domain, required for calcium binding. Mouse models for Huntington's disease displayed increased levels of the protein encoded by this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for one allele of this gene occasionally exhibit reduced viability but are usually normal. Homozygotes for another allele die as embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T A 9: 119,148,394 M407L possibly damaging Het
Acsf2 T C 11: 94,569,942 probably benign Het
Apob A G 12: 8,010,353 D2945G probably benign Het
Atg2a T C 19: 6,257,460 Y1475H probably damaging Het
Ccdc152 A G 15: 3,292,378 probably null Het
Ccdc7b A G 8: 129,072,714 M91V possibly damaging Het
Cd3g T C 9: 44,973,631 E105G possibly damaging Het
Cdadc1 A G 14: 59,596,911 L44P probably damaging Het
Cdh23 A G 10: 60,331,317 V1852A possibly damaging Het
Cdx2 T C 5: 147,302,023 Q252R possibly damaging Het
Cps1 A T 1: 67,157,764 I325F probably benign Het
Dctn1 G A 6: 83,197,949 probably null Het
Dcun1d3 T C 7: 119,858,033 K152R probably benign Het
Dhx35 G A 2: 158,831,785 V379M probably damaging Het
Fam171a2 T C 11: 102,439,981 E224G possibly damaging Het
Flt1 G T 5: 147,634,483 Y671* probably null Het
Fndc3b T C 3: 27,461,773 Y628C probably damaging Het
Foxj3 A T 4: 119,585,811 D144V probably damaging Het
Gp2 A G 7: 119,449,108 V429A probably damaging Het
Hydin T A 8: 110,452,058 I1095N probably benign Het
Kat2a A G 11: 100,708,240 F571S probably damaging Het
Kcnq1 C A 7: 143,148,756 probably benign Het
Letm2 A C 8: 25,587,325 S250A possibly damaging Het
Llgl1 T C 11: 60,709,460 V545A probably benign Het
Lrfn3 T C 7: 30,359,606 D398G probably benign Het
Lrig1 G T 6: 94,699,539 C49* probably null Het
Mug1 A G 6: 121,878,493 I929V probably benign Het
Naaa G A 5: 92,263,455 T291I probably damaging Het
Ndufaf1 G A 2: 119,660,040 Q180* probably null Het
Nr3c1 A T 18: 39,415,699 H741Q probably damaging Het
Nsun5 T C 5: 135,371,350 L109P probably damaging Het
Pacsin3 A G 2: 91,260,260 E18G probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Slc35a4 A T 18: 36,682,341 T75S probably benign Het
Slc52a2 T C 15: 76,541,074 I434T probably benign Het
Slco2a1 C T 9: 103,050,256 T116I probably damaging Het
Snrpd2 T C 7: 19,152,613 probably null Het
Tbc1d32 T A 10: 56,088,393 L903F probably damaging Het
Tex10 G T 4: 48,460,046 T435K probably damaging Het
Tmem266 T C 9: 55,380,836 S66P probably damaging Het
Top2b A T 14: 16,400,106 E581D possibly damaging Het
Uggt1 A T 1: 36,161,771 probably null Het
Wdr47 T A 3: 108,633,156 Y622* probably null Het
Zfp644 A T 5: 106,637,123 H519Q probably damaging Het
Zfp687 T C 3: 95,011,217 M415V possibly damaging Het
Other mutations in Capn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Capn5 APN 7 98135764 missense probably damaging 1.00
IGL01311:Capn5 APN 7 98161923 missense probably damaging 1.00
IGL01768:Capn5 APN 7 98125273 missense probably damaging 1.00
IGL01926:Capn5 APN 7 98128472 critical splice donor site probably null
IGL02076:Capn5 APN 7 98131743 nonsense probably null
IGL02505:Capn5 APN 7 98131196 missense possibly damaging 0.85
BB007:Capn5 UTSW 7 98123878 missense probably benign
BB017:Capn5 UTSW 7 98123878 missense probably benign
PIT4466001:Capn5 UTSW 7 98123988 missense probably benign 0.00
R0178:Capn5 UTSW 7 98132891 missense probably damaging 1.00
R0518:Capn5 UTSW 7 98132882 missense probably damaging 1.00
R0521:Capn5 UTSW 7 98132882 missense probably damaging 1.00
R1459:Capn5 UTSW 7 98131842 missense possibly damaging 0.84
R2005:Capn5 UTSW 7 98129363 missense probably benign
R2258:Capn5 UTSW 7 98135875 missense probably damaging 0.99
R2327:Capn5 UTSW 7 98126367 missense probably benign 0.07
R3797:Capn5 UTSW 7 98125829 missense probably null 0.77
R4032:Capn5 UTSW 7 98129246 missense probably damaging 0.96
R4620:Capn5 UTSW 7 98129371 missense probably damaging 0.98
R4717:Capn5 UTSW 7 98123919 missense probably benign 0.02
R4777:Capn5 UTSW 7 98131718 missense probably damaging 1.00
R4823:Capn5 UTSW 7 98126441 missense probably damaging 1.00
R4841:Capn5 UTSW 7 98131672 splice site probably null
R4965:Capn5 UTSW 7 98126417 missense probably damaging 0.99
R5568:Capn5 UTSW 7 98125930 missense probably damaging 1.00
R5792:Capn5 UTSW 7 98131195 missense probably benign 0.09
R6892:Capn5 UTSW 7 98135941 missense probably damaging 1.00
R6923:Capn5 UTSW 7 98129254 missense probably damaging 1.00
R7095:Capn5 UTSW 7 98125831 missense probably benign 0.10
R7391:Capn5 UTSW 7 98131219 missense probably benign 0.02
R7553:Capn5 UTSW 7 98124024 missense probably damaging 1.00
R7930:Capn5 UTSW 7 98123878 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGTCACTCAGGTCCATGG -3'
(R):5'- ACACCAGCTACACGTACATTCTTG -3'

Sequencing Primer
(F):5'- TCACTCAGGTCCATGGCTGAC -3'
(R):5'- GGTTCATCCCATTTTACAGATGAGG -3'
Posted On2017-01-03