Incidental Mutation 'R5732:Capn5'
ID 451490
Institutional Source Beutler Lab
Gene Symbol Capn5
Ensembl Gene ENSMUSG00000035547
Gene Name calpain 5
Synonyms
MMRRC Submission 043347-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R5732 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 97770766-97827481 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 97778593 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 342 (L342P)
Ref Sequence ENSEMBL: ENSMUSP00000102729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040971] [ENSMUST00000107112]
AlphaFold O08688
Predicted Effect possibly damaging
Transcript: ENSMUST00000040971
AA Change: L342P

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048183
Gene: ENSMUSG00000035547
AA Change: L342P

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107112
AA Change: L342P

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102729
Gene: ENSMUSG00000035547
AA Change: L342P

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the calpain family of proteins. Unlike many members of the calpain gene family, this gene lacks a calmodulin-like domain, required for calcium binding. Mouse models for Huntington's disease displayed increased levels of the protein encoded by this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for one allele of this gene occasionally exhibit reduced viability but are usually normal. Homozygotes for another allele die as embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T A 9: 118,977,462 (GRCm39) M407L possibly damaging Het
Acsf2 T C 11: 94,460,768 (GRCm39) probably benign Het
Apob A G 12: 8,060,353 (GRCm39) D2945G probably benign Het
Atg2a T C 19: 6,307,490 (GRCm39) Y1475H probably damaging Het
Ccdc152 A G 15: 3,321,860 (GRCm39) probably null Het
Ccdc7b A G 8: 129,799,195 (GRCm39) M91V possibly damaging Het
Cd3g T C 9: 44,884,929 (GRCm39) E105G possibly damaging Het
Cdadc1 A G 14: 59,834,360 (GRCm39) L44P probably damaging Het
Cdh23 A G 10: 60,167,096 (GRCm39) V1852A possibly damaging Het
Cdx2 T C 5: 147,238,833 (GRCm39) Q252R possibly damaging Het
Cps1 A T 1: 67,196,923 (GRCm39) I325F probably benign Het
Dctn1 G A 6: 83,174,931 (GRCm39) probably null Het
Dcun1d3 T C 7: 119,457,256 (GRCm39) K152R probably benign Het
Dhx35 G A 2: 158,673,705 (GRCm39) V379M probably damaging Het
Fam171a2 T C 11: 102,330,807 (GRCm39) E224G possibly damaging Het
Flt1 G T 5: 147,571,293 (GRCm39) Y671* probably null Het
Fndc3b T C 3: 27,515,922 (GRCm39) Y628C probably damaging Het
Foxj3 A T 4: 119,443,008 (GRCm39) D144V probably damaging Het
Gp2 A G 7: 119,048,331 (GRCm39) V429A probably damaging Het
Hydin T A 8: 111,178,690 (GRCm39) I1095N probably benign Het
Kat2a A G 11: 100,599,066 (GRCm39) F571S probably damaging Het
Kcnq1 C A 7: 142,702,493 (GRCm39) probably benign Het
Letm2 A C 8: 26,077,341 (GRCm39) S250A possibly damaging Het
Llgl1 T C 11: 60,600,286 (GRCm39) V545A probably benign Het
Lrfn3 T C 7: 30,059,031 (GRCm39) D398G probably benign Het
Lrig1 G T 6: 94,676,520 (GRCm39) C49* probably null Het
Mug1 A G 6: 121,855,452 (GRCm39) I929V probably benign Het
Naaa G A 5: 92,411,314 (GRCm39) T291I probably damaging Het
Ndufaf1 G A 2: 119,490,521 (GRCm39) Q180* probably null Het
Nr3c1 A T 18: 39,548,752 (GRCm39) H741Q probably damaging Het
Nsun5 T C 5: 135,400,204 (GRCm39) L109P probably damaging Het
Pacsin3 A G 2: 91,090,605 (GRCm39) E18G probably damaging Het
Rpgr G A X: 10,032,511 (GRCm39) P857L probably benign Het
Siglec1 G A 2: 130,916,188 (GRCm39) T1254M probably benign Het
Slc35a4 A T 18: 36,815,394 (GRCm39) T75S probably benign Het
Slc52a2 T C 15: 76,425,274 (GRCm39) I434T probably benign Het
Slco2a1 C T 9: 102,927,455 (GRCm39) T116I probably damaging Het
Snrpd2 T C 7: 18,886,538 (GRCm39) probably null Het
Tbc1d32 T A 10: 55,964,489 (GRCm39) L903F probably damaging Het
Tex10 G T 4: 48,460,046 (GRCm39) T435K probably damaging Het
Tmem266 T C 9: 55,288,120 (GRCm39) S66P probably damaging Het
Top2b A T 14: 16,400,106 (GRCm38) E581D possibly damaging Het
Uggt1 A T 1: 36,200,852 (GRCm39) probably null Het
Wdr47 T A 3: 108,540,472 (GRCm39) Y622* probably null Het
Zfp644 A T 5: 106,784,989 (GRCm39) H519Q probably damaging Het
Zfp687 T C 3: 94,918,528 (GRCm39) M415V possibly damaging Het
Other mutations in Capn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Capn5 APN 7 97,784,971 (GRCm39) missense probably damaging 1.00
IGL01311:Capn5 APN 7 97,811,130 (GRCm39) missense probably damaging 1.00
IGL01768:Capn5 APN 7 97,774,480 (GRCm39) missense probably damaging 1.00
IGL01926:Capn5 APN 7 97,777,679 (GRCm39) critical splice donor site probably null
IGL02076:Capn5 APN 7 97,780,950 (GRCm39) nonsense probably null
IGL02505:Capn5 APN 7 97,780,403 (GRCm39) missense possibly damaging 0.85
BB007:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
BB017:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
PIT4466001:Capn5 UTSW 7 97,773,195 (GRCm39) missense probably benign 0.00
R0178:Capn5 UTSW 7 97,782,098 (GRCm39) missense probably damaging 1.00
R0518:Capn5 UTSW 7 97,782,089 (GRCm39) missense probably damaging 1.00
R0521:Capn5 UTSW 7 97,782,089 (GRCm39) missense probably damaging 1.00
R1459:Capn5 UTSW 7 97,781,049 (GRCm39) missense possibly damaging 0.84
R2005:Capn5 UTSW 7 97,778,570 (GRCm39) missense probably benign
R2258:Capn5 UTSW 7 97,785,082 (GRCm39) missense probably damaging 0.99
R2327:Capn5 UTSW 7 97,775,574 (GRCm39) missense probably benign 0.07
R3797:Capn5 UTSW 7 97,775,036 (GRCm39) missense probably null 0.77
R4032:Capn5 UTSW 7 97,778,453 (GRCm39) missense probably damaging 0.96
R4620:Capn5 UTSW 7 97,778,578 (GRCm39) missense probably damaging 0.98
R4717:Capn5 UTSW 7 97,773,126 (GRCm39) missense probably benign 0.02
R4777:Capn5 UTSW 7 97,780,925 (GRCm39) missense probably damaging 1.00
R4823:Capn5 UTSW 7 97,775,648 (GRCm39) missense probably damaging 1.00
R4841:Capn5 UTSW 7 97,780,879 (GRCm39) splice site probably null
R4965:Capn5 UTSW 7 97,775,624 (GRCm39) missense probably damaging 0.99
R5568:Capn5 UTSW 7 97,775,137 (GRCm39) missense probably damaging 1.00
R5792:Capn5 UTSW 7 97,780,402 (GRCm39) missense probably benign 0.09
R6892:Capn5 UTSW 7 97,785,148 (GRCm39) missense probably damaging 1.00
R6923:Capn5 UTSW 7 97,778,461 (GRCm39) missense probably damaging 1.00
R7095:Capn5 UTSW 7 97,775,038 (GRCm39) missense probably benign 0.10
R7391:Capn5 UTSW 7 97,780,426 (GRCm39) missense probably benign 0.02
R7553:Capn5 UTSW 7 97,773,231 (GRCm39) missense probably damaging 1.00
R7930:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
R8876:Capn5 UTSW 7 97,780,902 (GRCm39) missense probably benign 0.01
R8914:Capn5 UTSW 7 97,784,997 (GRCm39) missense probably damaging 0.99
R9012:Capn5 UTSW 7 97,814,050 (GRCm39) start gained probably benign
R9087:Capn5 UTSW 7 97,775,531 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTCACTCAGGTCCATGG -3'
(R):5'- ACACCAGCTACACGTACATTCTTG -3'

Sequencing Primer
(F):5'- TCACTCAGGTCCATGGCTGAC -3'
(R):5'- GGTTCATCCCATTTTACAGATGAGG -3'
Posted On 2017-01-03