Incidental Mutation 'R5732:Gp2'
ID451491
Institutional Source Beutler Lab
Gene Symbol Gp2
Ensembl Gene ENSMUSG00000030954
Gene Nameglycoprotein 2 (zymogen granule membrane)
Synonyms2310037I18Rik
MMRRC Submission 043347-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5732 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location119442537-119459285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119449108 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 429 (V429A)
Ref Sequence ENSEMBL: ENSMUSP00000146487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033255] [ENSMUST00000207887]
Predicted Effect probably damaging
Transcript: ENSMUST00000033255
AA Change: V429A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000033255
Gene: ENSMUSG00000030954
AA Change: V429A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:ZP 164 213 1e-11 BLAST
ZP 225 477 5.39e-79 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207887
AA Change: V429A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that is secreted from intracellular zymogen granules and associates with the plasma membrane via glycosylphosphatidylinositol (GPI) linkage. The encoded protein binds pathogens such as enterobacteria, thereby playing an important role in the innate immune response. The C-terminus of this protein is related to the C-terminus of the protein encoded by the neighboring gene, uromodulin (UMOD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous null mice display no obvious abnormalities in pancreas morphology and function, development, growth, weight, behavior, life span, or fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T A 9: 119,148,394 M407L possibly damaging Het
Acsf2 T C 11: 94,569,942 probably benign Het
Apob A G 12: 8,010,353 D2945G probably benign Het
Atg2a T C 19: 6,257,460 Y1475H probably damaging Het
Capn5 A G 7: 98,129,386 L342P possibly damaging Het
Ccdc152 A G 15: 3,292,378 probably null Het
Ccdc7b A G 8: 129,072,714 M91V possibly damaging Het
Cd3g T C 9: 44,973,631 E105G possibly damaging Het
Cdadc1 A G 14: 59,596,911 L44P probably damaging Het
Cdh23 A G 10: 60,331,317 V1852A possibly damaging Het
Cdx2 T C 5: 147,302,023 Q252R possibly damaging Het
Cps1 A T 1: 67,157,764 I325F probably benign Het
Dctn1 G A 6: 83,197,949 probably null Het
Dcun1d3 T C 7: 119,858,033 K152R probably benign Het
Dhx35 G A 2: 158,831,785 V379M probably damaging Het
Fam171a2 T C 11: 102,439,981 E224G possibly damaging Het
Flt1 G T 5: 147,634,483 Y671* probably null Het
Fndc3b T C 3: 27,461,773 Y628C probably damaging Het
Foxj3 A T 4: 119,585,811 D144V probably damaging Het
Hydin T A 8: 110,452,058 I1095N probably benign Het
Kat2a A G 11: 100,708,240 F571S probably damaging Het
Kcnq1 C A 7: 143,148,756 probably benign Het
Letm2 A C 8: 25,587,325 S250A possibly damaging Het
Llgl1 T C 11: 60,709,460 V545A probably benign Het
Lrfn3 T C 7: 30,359,606 D398G probably benign Het
Lrig1 G T 6: 94,699,539 C49* probably null Het
Mug1 A G 6: 121,878,493 I929V probably benign Het
Naaa G A 5: 92,263,455 T291I probably damaging Het
Ndufaf1 G A 2: 119,660,040 Q180* probably null Het
Nr3c1 A T 18: 39,415,699 H741Q probably damaging Het
Nsun5 T C 5: 135,371,350 L109P probably damaging Het
Pacsin3 A G 2: 91,260,260 E18G probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Slc35a4 A T 18: 36,682,341 T75S probably benign Het
Slc52a2 T C 15: 76,541,074 I434T probably benign Het
Slco2a1 C T 9: 103,050,256 T116I probably damaging Het
Snrpd2 T C 7: 19,152,613 probably null Het
Tbc1d32 T A 10: 56,088,393 L903F probably damaging Het
Tex10 G T 4: 48,460,046 T435K probably damaging Het
Tmem266 T C 9: 55,380,836 S66P probably damaging Het
Top2b A T 14: 16,400,106 E581D possibly damaging Het
Uggt1 A T 1: 36,161,771 probably null Het
Wdr47 T A 3: 108,633,156 Y622* probably null Het
Zfp644 A T 5: 106,637,123 H519Q probably damaging Het
Zfp687 T C 3: 95,011,217 M415V possibly damaging Het
Other mutations in Gp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Gp2 APN 7 119454390 missense probably damaging 0.96
IGL00818:Gp2 APN 7 119450127 missense possibly damaging 0.82
IGL01830:Gp2 APN 7 119451542 missense probably damaging 1.00
IGL02088:Gp2 APN 7 119454469 missense probably damaging 1.00
IGL02284:Gp2 APN 7 119450183 missense probably damaging 1.00
IGL02812:Gp2 APN 7 119452229 missense probably benign 0.01
IGL03049:Gp2 APN 7 119450294 missense possibly damaging 0.82
IGL03368:Gp2 APN 7 119452874 missense probably damaging 1.00
IGL03369:Gp2 APN 7 119451560 missense probably damaging 0.98
PIT4687001:Gp2 UTSW 7 119451578 missense possibly damaging 0.48
R0179:Gp2 UTSW 7 119452317 missense possibly damaging 0.81
R0367:Gp2 UTSW 7 119454568 missense probably damaging 1.00
R0544:Gp2 UTSW 7 119454496 missense probably benign 0.00
R0973:Gp2 UTSW 7 119454543 missense probably damaging 1.00
R0973:Gp2 UTSW 7 119454543 missense probably damaging 1.00
R0974:Gp2 UTSW 7 119454543 missense probably damaging 1.00
R1413:Gp2 UTSW 7 119451630 missense probably benign 0.15
R1557:Gp2 UTSW 7 119450079 missense probably damaging 1.00
R1638:Gp2 UTSW 7 119451498 critical splice donor site probably null
R1709:Gp2 UTSW 7 119451585 missense probably null 1.00
R1932:Gp2 UTSW 7 119454232 missense possibly damaging 0.81
R2109:Gp2 UTSW 7 119452932 missense probably benign
R2159:Gp2 UTSW 7 119452284 missense probably benign 0.06
R2285:Gp2 UTSW 7 119450085 missense possibly damaging 0.82
R4657:Gp2 UTSW 7 119457168 missense probably benign 0.38
R4829:Gp2 UTSW 7 119457184 missense possibly damaging 0.56
R4854:Gp2 UTSW 7 119452199 missense possibly damaging 0.72
R4927:Gp2 UTSW 7 119452895 missense probably benign 0.00
R5022:Gp2 UTSW 7 119449114 missense probably damaging 1.00
R5033:Gp2 UTSW 7 119454291 missense probably damaging 0.99
R5443:Gp2 UTSW 7 119454598 missense possibly damaging 0.60
R5444:Gp2 UTSW 7 119454598 missense possibly damaging 0.60
R5681:Gp2 UTSW 7 119452294 missense possibly damaging 0.92
R5964:Gp2 UTSW 7 119449129 missense probably benign 0.02
R6963:Gp2 UTSW 7 119452897 missense probably benign 0.03
R7014:Gp2 UTSW 7 119451645 missense probably damaging 1.00
R7087:Gp2 UTSW 7 119450232 missense probably damaging 0.99
R7223:Gp2 UTSW 7 119451498 critical splice donor site probably null
R7497:Gp2 UTSW 7 119454606 missense probably damaging 1.00
R8165:Gp2 UTSW 7 119450152 missense probably damaging 1.00
R8343:Gp2 UTSW 7 119442787 missense probably benign 0.01
R8344:Gp2 UTSW 7 119442787 missense probably benign 0.01
R8345:Gp2 UTSW 7 119442787 missense probably benign 0.01
X0026:Gp2 UTSW 7 119442819 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGTAGAGAGTCGACTGGGC -3'
(R):5'- TGATTAACCACCCCTAGATTACTTACC -3'

Sequencing Primer
(F):5'- CACCAATACAAAGAGACACTCACTGG -3'
(R):5'- GAGACATGTCCCAGAAACTGTGC -3'
Posted On2017-01-03