Incidental Mutation 'R5732:Dcun1d3'
ID451492
Institutional Source Beutler Lab
Gene Symbol Dcun1d3
Ensembl Gene ENSMUSG00000048787
Gene NameDCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae)
Synonyms
MMRRC Submission 043347-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R5732 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location119852796-119896298 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119858033 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 152 (K152R)
Ref Sequence ENSEMBL: ENSMUSP00000118439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059851] [ENSMUST00000098080] [ENSMUST00000106519] [ENSMUST00000137888] [ENSMUST00000142120] [ENSMUST00000207233]
Predicted Effect probably benign
Transcript: ENSMUST00000059851
AA Change: K152R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000058968
Gene: ENSMUSG00000048787
AA Change: K152R

DomainStartEndE-ValueType
Pfam:Cullin_binding 161 277 6.5e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098080
AA Change: K152R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095686
Gene: ENSMUSG00000048787
AA Change: K152R

DomainStartEndE-ValueType
Pfam:Cullin_binding 159 278 1.8e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106519
AA Change: K152R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102129
Gene: ENSMUSG00000048787
AA Change: K152R

DomainStartEndE-ValueType
Pfam:Cullin_binding 159 278 1.8e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137888
Predicted Effect probably benign
Transcript: ENSMUST00000142120
AA Change: K152R

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000118439
Gene: ENSMUSG00000048787
AA Change: K152R

DomainStartEndE-ValueType
PDB:4GBA|B 86 165 8e-53 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000207233
AA Change: K152R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T A 9: 119,148,394 M407L possibly damaging Het
Acsf2 T C 11: 94,569,942 probably benign Het
Apob A G 12: 8,010,353 D2945G probably benign Het
Atg2a T C 19: 6,257,460 Y1475H probably damaging Het
Capn5 A G 7: 98,129,386 L342P possibly damaging Het
Ccdc152 A G 15: 3,292,378 probably null Het
Ccdc7b A G 8: 129,072,714 M91V possibly damaging Het
Cd3g T C 9: 44,973,631 E105G possibly damaging Het
Cdadc1 A G 14: 59,596,911 L44P probably damaging Het
Cdh23 A G 10: 60,331,317 V1852A possibly damaging Het
Cdx2 T C 5: 147,302,023 Q252R possibly damaging Het
Cps1 A T 1: 67,157,764 I325F probably benign Het
Dctn1 G A 6: 83,197,949 probably null Het
Dhx35 G A 2: 158,831,785 V379M probably damaging Het
Fam171a2 T C 11: 102,439,981 E224G possibly damaging Het
Flt1 G T 5: 147,634,483 Y671* probably null Het
Fndc3b T C 3: 27,461,773 Y628C probably damaging Het
Foxj3 A T 4: 119,585,811 D144V probably damaging Het
Gp2 A G 7: 119,449,108 V429A probably damaging Het
Hydin T A 8: 110,452,058 I1095N probably benign Het
Kat2a A G 11: 100,708,240 F571S probably damaging Het
Kcnq1 C A 7: 143,148,756 probably benign Het
Letm2 A C 8: 25,587,325 S250A possibly damaging Het
Llgl1 T C 11: 60,709,460 V545A probably benign Het
Lrfn3 T C 7: 30,359,606 D398G probably benign Het
Lrig1 G T 6: 94,699,539 C49* probably null Het
Mug1 A G 6: 121,878,493 I929V probably benign Het
Naaa G A 5: 92,263,455 T291I probably damaging Het
Ndufaf1 G A 2: 119,660,040 Q180* probably null Het
Nr3c1 A T 18: 39,415,699 H741Q probably damaging Het
Nsun5 T C 5: 135,371,350 L109P probably damaging Het
Pacsin3 A G 2: 91,260,260 E18G probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Slc35a4 A T 18: 36,682,341 T75S probably benign Het
Slc52a2 T C 15: 76,541,074 I434T probably benign Het
Slco2a1 C T 9: 103,050,256 T116I probably damaging Het
Snrpd2 T C 7: 19,152,613 probably null Het
Tbc1d32 T A 10: 56,088,393 L903F probably damaging Het
Tex10 G T 4: 48,460,046 T435K probably damaging Het
Tmem266 T C 9: 55,380,836 S66P probably damaging Het
Top2b A T 14: 16,400,106 E581D possibly damaging Het
Uggt1 A T 1: 36,161,771 probably null Het
Wdr47 T A 3: 108,633,156 Y622* probably null Het
Zfp644 A T 5: 106,637,123 H519Q probably damaging Het
Zfp687 T C 3: 95,011,217 M415V possibly damaging Het
Other mutations in Dcun1d3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0432:Dcun1d3 UTSW 7 119857950 nonsense probably null
R1219:Dcun1d3 UTSW 7 119859408 missense probably damaging 0.99
R1344:Dcun1d3 UTSW 7 119857935 missense probably damaging 1.00
R1418:Dcun1d3 UTSW 7 119857935 missense probably damaging 1.00
R4115:Dcun1d3 UTSW 7 119859734 missense probably benign
R4654:Dcun1d3 UTSW 7 119859519 missense probably damaging 1.00
R4784:Dcun1d3 UTSW 7 119857664 missense probably damaging 1.00
R5112:Dcun1d3 UTSW 7 119858027 missense probably damaging 0.98
R5935:Dcun1d3 UTSW 7 119859576 missense probably benign
R6037:Dcun1d3 UTSW 7 119857742 missense probably damaging 1.00
R6037:Dcun1d3 UTSW 7 119857742 missense probably damaging 1.00
R6224:Dcun1d3 UTSW 7 119859491 nonsense probably null
R7289:Dcun1d3 UTSW 7 119859641 missense possibly damaging 0.56
R7311:Dcun1d3 UTSW 7 119859511 missense probably damaging 0.96
R7658:Dcun1d3 UTSW 7 119857668 missense probably damaging 1.00
RF007:Dcun1d3 UTSW 7 119859503 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TCCATAGGGCAATGGCTATTTCA -3'
(R):5'- AAGGCACAGTTATTGTTGTTGGG -3'

Sequencing Primer
(F):5'- GCAATGGCTATTTCACGATGCAG -3'
(R):5'- CCTTAGCTGACCTTAGTAGACAAGG -3'
Posted On2017-01-03