Incidental Mutation 'R5732:Cd3g'
ID451496
Institutional Source Beutler Lab
Gene Symbol Cd3g
Ensembl Gene ENSMUSG00000002033
Gene NameCD3 antigen, gamma polypeptide
SynonymsT3g, Ctg3, Ctg-3
MMRRC Submission 043347-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5732 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location44969572-44980431 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44973631 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 105 (E105G)
Ref Sequence ENSEMBL: ENSMUSP00000002101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002101] [ENSMUST00000160886]
PDB Structure
CD3 Epsilon and gamma Ectodomain Fragment Complex in Single-Chain Construct [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002101
AA Change: E105G

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000002101
Gene: ENSMUSG00000002033
AA Change: E105G

DomainStartEndE-ValueType
IGc2 37 94 3.51e-8 SMART
transmembrane domain 115 137 N/A INTRINSIC
ITAM 157 177 2.06e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159019
Predicted Effect probably benign
Transcript: ENSMUST00000160886
AA Change: E97G

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000125151
Gene: ENSMUSG00000002033
AA Change: E97G

DomainStartEndE-ValueType
IGc2 29 86 3.51e-8 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the CD3-gamma polypeptide, which together with CD3-epsilon, -delta and -zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T-cell receptor-CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The genes encoding the epsilon, gamma and delta polypeptides are located in the same cluster on chromosome 11. Defects in this gene are associated with T cell immunodeficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased thymocyte number and T cell response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T A 9: 119,148,394 M407L possibly damaging Het
Acsf2 T C 11: 94,569,942 probably benign Het
Apob A G 12: 8,010,353 D2945G probably benign Het
Atg2a T C 19: 6,257,460 Y1475H probably damaging Het
Capn5 A G 7: 98,129,386 L342P possibly damaging Het
Ccdc152 A G 15: 3,292,378 probably null Het
Ccdc7b A G 8: 129,072,714 M91V possibly damaging Het
Cdadc1 A G 14: 59,596,911 L44P probably damaging Het
Cdh23 A G 10: 60,331,317 V1852A possibly damaging Het
Cdx2 T C 5: 147,302,023 Q252R possibly damaging Het
Cps1 A T 1: 67,157,764 I325F probably benign Het
Dctn1 G A 6: 83,197,949 probably null Het
Dcun1d3 T C 7: 119,858,033 K152R probably benign Het
Dhx35 G A 2: 158,831,785 V379M probably damaging Het
Fam171a2 T C 11: 102,439,981 E224G possibly damaging Het
Flt1 G T 5: 147,634,483 Y671* probably null Het
Fndc3b T C 3: 27,461,773 Y628C probably damaging Het
Foxj3 A T 4: 119,585,811 D144V probably damaging Het
Gp2 A G 7: 119,449,108 V429A probably damaging Het
Hydin T A 8: 110,452,058 I1095N probably benign Het
Kat2a A G 11: 100,708,240 F571S probably damaging Het
Kcnq1 C A 7: 143,148,756 probably benign Het
Letm2 A C 8: 25,587,325 S250A possibly damaging Het
Llgl1 T C 11: 60,709,460 V545A probably benign Het
Lrfn3 T C 7: 30,359,606 D398G probably benign Het
Lrig1 G T 6: 94,699,539 C49* probably null Het
Mug1 A G 6: 121,878,493 I929V probably benign Het
Naaa G A 5: 92,263,455 T291I probably damaging Het
Ndufaf1 G A 2: 119,660,040 Q180* probably null Het
Nr3c1 A T 18: 39,415,699 H741Q probably damaging Het
Nsun5 T C 5: 135,371,350 L109P probably damaging Het
Pacsin3 A G 2: 91,260,260 E18G probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Slc35a4 A T 18: 36,682,341 T75S probably benign Het
Slc52a2 T C 15: 76,541,074 I434T probably benign Het
Slco2a1 C T 9: 103,050,256 T116I probably damaging Het
Snrpd2 T C 7: 19,152,613 probably null Het
Tbc1d32 T A 10: 56,088,393 L903F probably damaging Het
Tex10 G T 4: 48,460,046 T435K probably damaging Het
Tmem266 T C 9: 55,380,836 S66P probably damaging Het
Top2b A T 14: 16,400,106 E581D possibly damaging Het
Uggt1 A T 1: 36,161,771 probably null Het
Wdr47 T A 3: 108,633,156 Y622* probably null Het
Zfp644 A T 5: 106,637,123 H519Q probably damaging Het
Zfp687 T C 3: 95,011,217 M415V possibly damaging Het
Other mutations in Cd3g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01881:Cd3g APN 9 44971268 missense probably damaging 1.00
IGL02624:Cd3g APN 9 44974161 critical splice donor site probably null
IGL02750:Cd3g APN 9 44971310 unclassified probably benign
IGL03097:Cd3g UTSW 9 44970763 missense probably damaging 1.00
R1711:Cd3g UTSW 9 44974342 missense probably damaging 1.00
R2076:Cd3g UTSW 9 44974297 missense probably damaging 1.00
R3614:Cd3g UTSW 9 44980289 missense probably benign 0.39
R4514:Cd3g UTSW 9 44973584 missense possibly damaging 0.93
R6520:Cd3g UTSW 9 44971315 splice site probably null
R7447:Cd3g UTSW 9 44973559 missense probably damaging 1.00
R7776:Cd3g UTSW 9 44974161 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GACAGGGTATTGCTCTATTGCC -3'
(R):5'- TGCACCTCATGGATAAGAGCAG -3'

Sequencing Primer
(F):5'- TTGCCTTGCAAGAACCACC -3'
(R):5'- CACCTAGTTCCTGAATGTAGGACTG -3'
Posted On2017-01-03