Incidental Mutation 'R5732:Tmem266'
ID451497
Institutional Source Beutler Lab
Gene Symbol Tmem266
Ensembl Gene ENSMUSG00000032313
Gene Nametransmembrane protein 266
SynonymsAI118078
MMRRC Submission 043347-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5732 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location55326913-55438345 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55380836 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 66 (S66P)
Ref Sequence ENSEMBL: ENSMUSP00000034862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034862] [ENSMUST00000085754]
Predicted Effect probably damaging
Transcript: ENSMUST00000034862
AA Change: S66P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034862
Gene: ENSMUSG00000032313
AA Change: S66P

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
transmembrane domain 95 117 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 172 191 N/A INTRINSIC
low complexity region 260 283 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
low complexity region 381 396 N/A INTRINSIC
low complexity region 423 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085754
SMART Domains Protein: ENSMUSP00000082906
Gene: ENSMUSG00000032313

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
low complexity region 195 218 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130465
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.8%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T A 9: 119,148,394 M407L possibly damaging Het
Acsf2 T C 11: 94,569,942 probably benign Het
Apob A G 12: 8,010,353 D2945G probably benign Het
Atg2a T C 19: 6,257,460 Y1475H probably damaging Het
Capn5 A G 7: 98,129,386 L342P possibly damaging Het
Ccdc152 A G 15: 3,292,378 probably null Het
Ccdc7b A G 8: 129,072,714 M91V possibly damaging Het
Cd3g T C 9: 44,973,631 E105G possibly damaging Het
Cdadc1 A G 14: 59,596,911 L44P probably damaging Het
Cdh23 A G 10: 60,331,317 V1852A possibly damaging Het
Cdx2 T C 5: 147,302,023 Q252R possibly damaging Het
Cps1 A T 1: 67,157,764 I325F probably benign Het
Dctn1 G A 6: 83,197,949 probably null Het
Dcun1d3 T C 7: 119,858,033 K152R probably benign Het
Dhx35 G A 2: 158,831,785 V379M probably damaging Het
Fam171a2 T C 11: 102,439,981 E224G possibly damaging Het
Flt1 G T 5: 147,634,483 Y671* probably null Het
Fndc3b T C 3: 27,461,773 Y628C probably damaging Het
Foxj3 A T 4: 119,585,811 D144V probably damaging Het
Gp2 A G 7: 119,449,108 V429A probably damaging Het
Hydin T A 8: 110,452,058 I1095N probably benign Het
Kat2a A G 11: 100,708,240 F571S probably damaging Het
Kcnq1 C A 7: 143,148,756 probably benign Het
Letm2 A C 8: 25,587,325 S250A possibly damaging Het
Llgl1 T C 11: 60,709,460 V545A probably benign Het
Lrfn3 T C 7: 30,359,606 D398G probably benign Het
Lrig1 G T 6: 94,699,539 C49* probably null Het
Mug1 A G 6: 121,878,493 I929V probably benign Het
Naaa G A 5: 92,263,455 T291I probably damaging Het
Ndufaf1 G A 2: 119,660,040 Q180* probably null Het
Nr3c1 A T 18: 39,415,699 H741Q probably damaging Het
Nsun5 T C 5: 135,371,350 L109P probably damaging Het
Pacsin3 A G 2: 91,260,260 E18G probably damaging Het
Rpgr G A X: 10,166,272 P857L probably benign Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Slc35a4 A T 18: 36,682,341 T75S probably benign Het
Slc52a2 T C 15: 76,541,074 I434T probably benign Het
Slco2a1 C T 9: 103,050,256 T116I probably damaging Het
Snrpd2 T C 7: 19,152,613 probably null Het
Tbc1d32 T A 10: 56,088,393 L903F probably damaging Het
Tex10 G T 4: 48,460,046 T435K probably damaging Het
Top2b A T 14: 16,400,106 E581D possibly damaging Het
Uggt1 A T 1: 36,161,771 probably null Het
Wdr47 T A 3: 108,633,156 Y622* probably null Het
Zfp644 A T 5: 106,637,123 H519Q probably damaging Het
Zfp687 T C 3: 95,011,217 M415V possibly damaging Het
Other mutations in Tmem266
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Tmem266 APN 9 55435202 missense probably benign 0.12
IGL03366:Tmem266 APN 9 55437233 missense probably benign 0.06
R0088:Tmem266 UTSW 9 55437329 missense probably damaging 1.00
R0418:Tmem266 UTSW 9 55437413 missense probably benign 0.06
R0497:Tmem266 UTSW 9 55380884 splice site probably null
R0763:Tmem266 UTSW 9 55414955 missense probably damaging 1.00
R1657:Tmem266 UTSW 9 55418008 missense probably damaging 1.00
R3617:Tmem266 UTSW 9 55400634 missense probably damaging 0.99
R4235:Tmem266 UTSW 9 55418107 missense probably damaging 0.99
R4767:Tmem266 UTSW 9 55380741 missense probably damaging 1.00
R5587:Tmem266 UTSW 9 55437566 missense probably damaging 1.00
R5783:Tmem266 UTSW 9 55397803 missense probably damaging 1.00
R6193:Tmem266 UTSW 9 55437209 missense probably benign 0.01
R6943:Tmem266 UTSW 9 55377567 start gained probably benign
R7459:Tmem266 UTSW 9 55396599 missense unknown
X0063:Tmem266 UTSW 9 55380749 missense probably benign 0.00
Z1177:Tmem266 UTSW 9 55397767 missense probably damaging 1.00
Z1177:Tmem266 UTSW 9 55437470 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TTTAGTTCTCAGGGGCTAACC -3'
(R):5'- GGTTGTCTAGCAGCAATGGG -3'

Sequencing Primer
(F):5'- GGCTAACCCTTCCCTGCCG -3'
(R):5'- GCAATGGGCATTTTCTGTACCCAG -3'
Posted On2017-01-03